Description :
From Genome Similarity Track
Location :
Scaffold_72:13254- 17179
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.2Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.53AP-3 complex subunit delta

Sequence
3925 bases(100 bases per row)
TGTGAATGTAGAGAGTTCGAGATCCCGCCGGGCTTTGAGGCcTTGCAGGGCAGCTCGACCATCACGCGCGAGTCGATCCTGTCCGGCGACAAGGAGCTCT
GGTTTTtCAAGCTCCCCAAGCACGTACGTTGTGCCACATCCACGCTGCGTATGAGGGACTCAGGAACATGGCTGACACGCGTGTGTGTCTTCTTGTAGCT
GGATGCGTCAGCACTGGCAaAGACGTCGTTCAAGCTCGGTAAGAGCGCCGCATCCACCGGTACCGTCGTGACCTCGATCAAGCACGAGGGCAAGACGTAC
AGTCTGCAGACGGAGGACGCGATGCTGAtCAACCAGCTCGTGAACGCTTTCCCACTGGCCAAGGAGCGCAAGAAGTTTACGCTCGGCAAGCCATTCGCTC
GGTGTTTCTCGCTCGTGGAAGACCGCCAGGAGCTGCACCGAGCAGCGACGGAGGACGAAGCACAGGCCGAGAAGGAGCAGACCGAGAAGCCGACCAAGAA
GAGCAAGAGCAGCAAGCACAAGCAGGAAGAAGCGCCTGCGTCCAGCACcAAGCCGTCCAAGAAGGCCAAGACCAAGAAATAGACGCCCTAGAAGAGCAAT
GCGTATGTATGAAAACCACAAACAACGACCTTTATGGAGAATGGAATGTCGTCGCGTCGCCTGACTAGTaGATGAGGgAGGGCGTGTGGTGGCCTACCGG
TACGACTGTACTACTGGTGAGTGACAGTGAAAGaGGAAACGGTCATCTAGAAGAGCAGCAGTGGCTCGTCGTGCGTgTTGGCGTTCTTGTCCTTGCTCTT
CTTCTTGGAagACGACGAAGACTtCTtCTCCTTGAGAgcGTGCGACGACTCATCCGTgAaGCGCTTCGACTTGCCAGTCGAGCTACTCGACTTCTTCTTG
TGCGAACTCTTACGTGTGTCTTCACCGTCCGAGCtGTCGTTCACGTAAaTATTCTCcTTtGCCTCGTCcTCGTGgCGCTTCGAGGACGACTTTTTCttCT
TTCGTTCGCCGTCATcTttATCTCGgTGCTTGCTGCtCTtCTTGagCTTCTTcGCCTCCTTGtCTTtGCTGCCCGACTTCTtCTTTTtCTTTTtCTTGTC
AGTATCGTTGTCTGGTGCATCGTACTGCTTCGTCTGTCTGTGGTACAGGTGCTCGTCTGGGATCTTCTCATCGTCACGTAGTGGCATCGACAAATCCACA
GCGGCAAGATCGTCATCCTGAGAACAGAAAACAGCATGAGCTTGAAGTCACGTGCcAATTCACTCTTCAACTGTTGCCATACCGCCTGAACACGCTTCTT
ACGGGATCGTCGTCGGTCTTCCTCGCTCGAGTTTGCTCCATCAGGCATAAGCTCGTCCTCGAGAATAACCTTCGACTTGCGCGTCTTCTTCGACTTTTTC
TTCTTGCCCGAGTTGTCGAGTGCGTCCATGATGTCAGCAAACCCCTACAAGATCCAAATATCAAACGTTAGCGTCGCTCAGGACGGATCAACACACGAGA
CACTCACGCTTTGGCCGAGGAGATCGTTGCCGTTGCTGTTGTTGGCACCTGATAGGTAGAATGGATCCTTGCGCAAACGCTCCTTCTCACGTTCGTACTC
CCGCTCGCGAGCTGCTCGCTCGTCAGCATCGGATTCGCTTTCGCTCGatCCAGACTTCGAATCGTACGAGCCTCGACGGGACGATTTGCCCTTcttGCTC
TTCTTTCGGGgCgATTCGATACCGATACCGTTGTAACCGTGCGTAGTTGAGCTGCTGAAGCTGTTTTGTtGTTGCACGAAGGAGACTTCCAGATCGTCCT
CGTTGGCGAAGACAGAGACATCTCCACCAGACTCGAGGAACGATGCTTCACTgAaGCTGAACGCTTCATCAAGGTCGAGATCGCCTGGCAGAGGCACCTT
GCGCTGAGCCTTGGCACCGACCGGCGCCAGTCGCTCAGCAAAGTAGCTGCTGAGAATGGCCACACGGGCGGAGGAATCAAGCGAGATACTGCTGTCAAAa
gCACGCGACGCGCGTTCCTCGGAGCTGAGCGAGCCGAAACCCAGACCGAGCGACAACAAGATCTGCTGTAGcGACACAGCACGTTCCTGGACTTCGATGT
GCTCGCTTtGGACGAACGCAGGCAAACGCTCGAGTACGAGCTCCGACAGCTTTTCCAGGgACGCATCATCCGCCCGGTCGGCCATCGCGGTGACGAACTT
GAGAAGCGTCTGAATGTACACTGTCTGTACGTGAGCAGGTAGGCTTGTGGTGCGAGGCTGCAACATCTCGTCGACAAGGTCGTGGATGTTGCCCAGCTTC
TCTTCTTCGGTCTCTTTCTCTTCGTCCTCGTCCTCGTCCTCTTCGTCATCCTCATctGTGTCGTCCAAGTACTCGGTCACGTACTCACCGGCgATCCACG
CAGCCGCGTAGAACACTTCACACAATGTGCTCGCGCCAGGACCCGTGAGAGCGTCCTTCTCCATAAGCAAGTCGATCATGTTTtCCACGATTACGCTGCG
CACACTCTTCACACGCACTGCGATGTCGATCAGCTGGCGGgCGACCTCAATGCCGTGCGACTTGGACGCAgAaTCGTCACTGTAGATGCTGCTCTTCAAA
CCAGCGCTGCCTGCACTGGCTGGATCCAACGTGAAGGCCGTGTTGCTCGGCACACGTGCGAGCTGCACGAGTACGTGGATGTACCAaTCAAAATCaTGGA
TGTTTTCGTACTTGTTGACCGAGCACACGTACAGAATGCGCGTGATGAGCTCGTGACGGTAAATGCCATCGGCTGACAGCGTCTGACGCATGAGCTCGCG
GATGATCTGCGCGGCATTGTCGGGAGTTACCATACCGGCAAGAAGTTCAAGCGCACGCATGCGAATCGTGATGTCGTCGACAGCGAGGCACTCGATAATC
AGAGCCTGGTGCTCGCCGATGACGAATGGGTGTGATTCCATGAGGTTGCTGAGGCCTACGAGGCCCAAGTACCGCAGGTTctGGTCCGTGTCCTCAATAA
AGCGTCGCAAGTGATCGTTACACAGGCGCACGACGGCAGGAACATTGCGTGGCTGGCTGCCGTCGCTCTTCTTGGTGTACAGCAGCGCCGTTGTGACCGT
GGCGATACATTCGTACAGCAGCGACTTGGCCGGCGTGTTCTGGATGATCGTCGCGAGCGGGTCGAGCAGCTTACGCGCCAGTCGCGGTTCTTCGGGCAcg
AGCGACGCCATGAGTTTGACCACCTTGATGAGCATCCAGTTGTTGGACGACGTCGTCAGCAGGCGGAAGAACTGTGGCGCGAGGCCCAGGTAGTTCTTCG
GCTTCTTGTTGGCCAGTTCACAGATCACGTTGACTGCACACGACACGACCGATACGTCAGGCTCTTCCATACGCTCCTTGAGCTTGTCGAACGTCAGGCG
CAGGCCCTGCGGgTACCGCAGGAAGACCTTGTACAGCACCAGCGTCGCCTTCTTGCGCACGTACGACTTGGGGCTATTCATCATGGCCACGACGTCACCC
AGCAGGTCGCGGGCGAGGTCGGTCGTGGCAATATTCGCCAGCACATTGATGGCAAGACCGACTTCGTACTCGTTGATCGAGCCGAACTCTTTCTTGAGCA
GGTTGGTGCACAGCAGCACAACGTCCGTCGTTTGCGTGAAGCTCTGCGACGCGGCCGTGTACCCAACGCGCTTGTGGGCAAAGCGCTCGTAGCTCATGAC
TTCGACAACGTGGAACGCCGCCCACGTCATGTCGTAGCCCAGCATGTGCAAGTACGTGAGCTTGCGCACAGCTTCGGCCTTgaGGAACGGGTCCGTgCTC
TTGAGCTCGGTCTTGATGTCCTGCATGGCCTGCGAGATGTAGACGCTGACATcGCCcTTGGCCGAGCGGATGCCcTTCAcAaGGTCCTGCAGGTTCTTCT
CGAACATGGTGGCGGCGGCGGCAGG