Description :
From Genome Similarity Track
Location :
Scaffold_5:1325281- 1330983
Transcript NameFunction/comments
Physo_562618PREDICTED: uncharacterized protein LOC101299743
Physo_348159DnaJ subfamily C member 2 protein

Sequence
5702 bases(100 bases per row)
GCACATCATGGAGATACCATCAGGAAATCTGTAGGGTGTGGGAAGTTGTCGGATCGCCGACTGGACTACAGACAACGACGGATAAATACGGCAACGCAAA
ACCCGGCACACATATGTTGTACTTTTTACAATAAGTTATTCATAAAGCCAATCAGCTTCGAGAGTTACACTTGACATTTGTATTCAATATGGTTGTTAAG
TACTTTCTCTAAATCTGTGTGAACTTTATGCTCCGTTACGTGTACTTTATGTCATTGCCTTGTACAATCTCTATCGTTCCCGACAGAGAATTCTGGCACA
TTTACTATGGAGGATGTCATTCAGTTATGCCGGATTTATCCGTCGTTGTCTGTATCGTCGATGCACTATTGGTGGTCGATTTCAATGCAATGGCGGCAGG
ATCCCCGGACAGCGCGCGTGAAGACAGCTGGGAGAAGGCGGTGGTGGCGGAAAGCTGCTCGAGCTACCTGCGAAGCGGAGACGCTGTCGGCACACGTACA
TACACGTCCACCTTGTTTGACAGATCAACGTGTACACTATGTACTGTATTGTCTTCACGAGACTAAAATAATTAGTCCCTCGTTAATCAGCGTTACAAGC
AACGCGATCATCAAAGCCGCCGGCGCGAAGGGTGTCAAACAGTTGGCGGCTTTCGCAGTCCACATATGCATCGACGGAAGCGTTACGCTGGGCGTAGAGC
GGCTTCACGCAATCTCTGGTGTTGGCCGAAAACATTCCTCTGGTATTCTTAGACGCTAGGCATTATCTTCACCCCCGTCCTGCTGTTGATACAAACTCGG
CATTACCAAGATCGTGCGGCCAAGTGGCGTTGTCATGTGCATGCCGACCAGTACGTACAGTAGGGAAACTCCAACCTTCTGGGTCATCACCACCCAGTGA
CGACTTTTATTTTAGCTTCGGCGTGTCGCTATGCTCGAAACAGCAGATTAGTGTGTCATTACTCCGGCATCAGCGTTCAGTATCCGCGTCGGATGCACTA
CGTTATAATAGCAATGGATTCGGTGCAGGGTGTTTACGTATTATTAGGCAAAACATTGTGAATATCAATGTAAGCTAATCGGTAGTCATCTTCTTCATTG
CGTGGTATGTGAAATCCCTTTCGAACCTGCAAAAAGTGTATTCTGCAAGAAGCCCACGAGAAAACATACTAAGAAGTACCCGACTGACGCTCACAATATT
CTTCAACAGCATATATGCTTTGATAAACGAAAGTACGAATTTAATCAACAGTGTGTGCCTGTTGGAATTGTTGGGTGCTAACTAAAGCTTAGAAGGGTAA
ATCCATAGATAACGAGTGTCTAGATAACTACAACTGTCAAGGGAGGGCGGGGTCCACTGGGCAGGCGTGGATATCTGGCCCTCTTCTATGACTATTAATA
CGGTAACGTTGCTACTGCAGCTCGACGTTTATTTGTCCTGCTACCGGGGATGGACAAGAGCGTGTTTGCTACAGTACATGCACCAGTTATGAAAGTGGTC
TCGATGTGGAAGTAGCCGAACACACTTCGGTTACTTTATTTATTAGGCCCTATAGTGCGCGTTTAGTCAACAAGCATATCTTACTTTTCTTTGCTACAAT
GCCAACGCAGACAATACCTGAGTTCACTCACAAGTAATACACGATGCGGGACAGTGTCGCGGGGTACACTATCTATACTGTATTCGACACGGATCGGGAA
ATATTAATACATGTTTTCCGCTGGTCCGAACGGGAATTCAAATACCACAGATAACGATTGCTGGATACCCTACTCTAATCCTCTTCTGTAAAGTAATGTT
TTGCCATACGTGCACACCCTGCACCGAATCCATTGCTATTATAACGTAGTGCATCCGACGCGGATACTGAACGCTGATGCCGGAGTAATGACACACTAAT
CTGCTGTTTCGAGCATAGCGACACGCCGAAGCTAAAATAAAAGTCGTCACTGGGTGGTGATGACCCAGAAGGTTGGAGTTTCCCTACTGTACGTACTGGT
CGGCATGCACATGACAACGCCACTTGGCCGCACGATCTTGGTAATGCCGAGTTTGTATCAACAGCAGGACGGGGGTGAAGATAATGCCTAGCGTCTAAGA
ATACCAGAGGAATGTTTTCGGCCAACACCAGAGATTGCGTGAAGCCGCTCTACGCCCAGCGTAACGCTTCCGTCGATGCATATGTGGACTGCGAAAGCCG
CCAACTGTTTGACACCCTTCGCGCCGGCGGCTTTGATGATCGCGTTGCTTGTAACGCTGATTAACGAGGGACTAATTATTTTAGTCTCGTGAAGACAATA
CAGTACATAGTGTACACGTTGATCTGTCAAACAAGGTGGACGTGTATGTACGTGTGCCGACAGCGTCTCCGCTTCGCAGGTAGCTCGAGCAGCTTTCCGC
CACCACCGCCTTCTCCCAGCTGTCTTCACGCGCGCTGTCCGGGGATCCTGCCGCCATTGCATTGAAATCGACCACCAATAGTGCATCGACGATAGTCCAG
TCGGCGATCCGACAACTTCCCACCCGCGTAAAGAACGTTCAAAAGGGTCGTTCATGTTTGAAACAGTTTTGAAGTGTCTAAAAGTCCAAAAGTACTTGCC
CTCCGCATCTTCCTGTCGAGTATACATTCCCCTGCCACTCCTGCCCTTCACGCACAGCTCGTTCGAGGACAGGGACCTTTCACCATGCACCCTGAACCAG
TTGCTGGCACGCTGCCAGCAGCTGCAGCATCCATCACGCCTCGCACTCCACAGTCAGGGAGGAGAAACCAACAAACTCCAGGATCAGCACCAAAAACGCA
CCGATCTCCGCCAGCATCAGCGCCGAGAAGCCTCCGATCCTCTCCTGCCTCAGCAGTGAGGCGATCTCCACGCTTTAGGCCGTACTCGAGTCCGACCCAA
CAGCCCCCGCAGACACCTAGAGTGCTACGGAAGATGGACTTCTCGTCGCCTCAATCGTCCACATCCGCCCGGCCGCCACGTTCTCCAGCTCCGCCCAGCC
AGTTGCGAGAATCGCCGATGAAGACGGGGCGCCCGCGTGACGACATTTGGCAACACTATGGCATTGAGCGCGAGAATGGTAAAAAGCATGGGCGATGCAG
ATACTGCGGCACTCAAGAAAAATGGCAAGCCGAGCGGTAATTTGCTAAAACACATGATCAATCCAGGCCAGTGCCCTAGTGTAGCAAGTTTCGCTTCGGC
CTGCGGATATTCCCGATCCGAACCCAACACCAGCTAAGACCGCCCCTCCCCAAGCAGCTGAGCTGAGTCAAGACGCCTTCGAGATGGCATTGGCACGTGT
TTTCTTCGTCTGTGCACTTCCATTTATGCTCATAGAGGCTCAGGTATTCCGAGACTTTATCGCCATGGTGGCTCCTACAATGAAGGTGCCTTCGAGGCAC
AAACTCAGCGTGGTTCTTCTAAAACGTGTGCGAGATGAGATGCGCGTGAAAGTTATCAAGTTGATAAACAAGCAAGTCTACGTGTCGCTAGTTACGGACG
GATGGAGCGATACAAATGGATCGAGTATCATCAATTTCATGGTAGTGGCGCCCGGCATGCCTTCGTTGTTCTGGTCATCATGGTCGACAAGGTCAGAGCA
GCACACAGCTGCGTACCTAGTAGGTGAAATTGACAAGGTCATCTCGGATATTGAAAGTGCCACGACCGCACACGTCGTTTCTGTCGTCACAGACAACGCA
AGAAACATGAGTAGTGCTCGAAGTCACATCCAGGCACGACGACCCAACGTGGTGAGTGGCGGCTGCTCCGCCCACGTGCTCAACCTGCTCATGCAAGATG
TGTGTCGCTTTCCTGTAATTCAAGCGGTCAGATCACGAGCTGTGGCTGTTACCCGTTTCGTTCGAGATCATTTGGCTCTACTTGATGAATTCAAGGCTCT
GCAGCAAGGCTTACGCGATACGGGTCTAAGCACAAGAAATCTGGTGTTGCCGGTGCCAACAGGTTGGTACTCAGTGTTTGCTTGCTTGCGCAGTGTGTTG
AACAGTCGTGAAGTACTTTAAAAATTATTTTTGAGTTCCGAGTATGAAGAATTCCGCGATCGATATCATGCAACTGCGCCAAACCGGAAGAAACTTCGCT
ACATGATGGAGCTCGTTCGTGACAACAGCTTTTGGGACAGCCTGAGGACCATCGTACGTCTGTTGGACCCTATAATTGAAGCACTAAGACAGCTTGAAGG
TGACAACGTGTTTGTGTCGGGGGGTTATAAGTGGTTTCGATGGCTACGGTATCACACCGCGTACGGCGTCACCTCACCTGAGCAAGATGATGAAGAGGCA
GTTGATGTGCCGGAGCCGTCTGAGCAAGCTGGCGTGCCGGGACCATCTGAACATGAAGCTGTTGATCAAGCTCGCAATGGAATCGAACTCCTTAGTAACT
CAGTCGATCTTTTAGCGCCCACCAACTCCGCCGGATCGCCGCCCACAGCGCCAGCCGAACTGCAGTCTGTACCAGCAAGCGAAACTTCCCCTGAAAGTAC
GTCACCGGATGATGAAAATTTATTAGCGGGAGGTAATTACAGACGTATCGATGTTCCGCAGCTCGACGAGCTTCAAGAATTTTTTCGTGACAAGATTCGA
AGTCGATGAAGCTACGTGCACTCCAACGCGATGAGTATCGCATTCTTGCTCGATTCATCGACGGATATAGATGACTTCGTTGGCGCTGATGATGAAAAAG
TTGATGACCAGGTGTGTGAAATGGCGAGGCGGTGTGGCTTGTTCACACCAACCGTGGGCGCCCCCGCATTTACTGCAGAGGTCCTTGCGTTTAAGAGTAA
GAAGCGGCGGGGTGGTAAGGCGATGCGTGAGAAGTATTCGATGTCAAGTCCGCGGGATTACTGGGAAGGGAAGAAATCTGAGCGATACCCACTGCTTCAG
AAGATAGCACAAATTGTGTTCGCGATCCCTACTTCGTCGGCTGCAAGCGAACGGGCTTGGAGTATCTTACTCGAAGCGGAGGAACAGGCTCTCAGTGGCA
AAAGTCGAGATGCTTGCATATGTGTATATCAACTATGGTACGATTCGAAGCGATTCGATGGACCTTGCCCGTCACCAGTCGCGTCCAGAAAGTGTAGATG
CTGATAGTTAATTGCCATCGAATAATACATGATACTACGTTTTGAATCTGTTTTTATTTTGCTGACCACTAAGATGTCCGTAGTGCTAGTTCACCAAGAA
CCAAGTTTGCTATTGTGTCGTACAGCGGCAATCCCTCATCGTGCAGCATTAGCAGCCGATATGATCGACGCGCCTAAATGTTGGCAGCGCGTCGCGGCAT
CTATCACTTTCTTTGGCGTGCATTAGACCTGGTCCTGTCGCTGCTTGTGCACAACGATATGCTCGAAGAAATCTTGAACTCCGCACTGACCTCAGCGTCT
CACCGAGACCGACTTGTAGTTCTTGCTTGTGGGCACACCCACGATACCCACGGTAGCGCTGACGCGACTGCCGAGAAAGGAGCGCTCGGGCTCTGTTCTC
TCGATTCAGTTCTTGACCTCGGTTGCGAAAAGCACGCTCTCTTCATTGGTCTCGGTGGAAGCGGCAGCCATCTTCTCCTTCTTCTGCTCGCTTGGGTCGC
GAAGTCGGTCGGGCTGGAACTCCTTATTGGCGCCCGGCTTAGCGCTCTTGATGATGCACAGGTTCCCGTTGTCGCGGTGCACCCGCAGGTGATAAGACTT
GG