Description :
From Genome Similarity Track
Location :
Scaffold_1:132500- 133911
Transcript NameFunction/comments
Phyta_totarag40hypothetical protein PHYSODRAFT_383555
Phyta_totarag41hypothetical protein PHYSODRAFT_477130

Sequence
1411 bases(100 bases per row)
TCCGTCCGCTGCGCCCCATCGTGCCCAGCCACGTGCTCATCGTGCCGCGCGCACACATCCGGAACGTTAATCGGCTGGCTGCGAGACATCGCGGACTGCT
CGCGCGGATGCACCGCGTAGCCGAGGCGGTTATGACCCAGGGACCAGAGAGTGGAGCGGTGGAGGACTGCGTCGAGTTACAGCCGCAGGAGCCGAAggac
gtacatgtacacgagGATGGGGACGAGAACCGCGTTCGCTACTCGTTCCATGTGCCGCCGTTCAACAGCATCGACCACGTGCACATGCACGCGTTCCTCG
ACGACCCGCGCAGCTTAGGTTACTACGGACGCCTCAAGTACCGCACCGagtcgtggtggtgtcgctCGTACGACCAGGTCATGGCCAGGCTGCAGGAACT
GGCCGCCGACGTCCAGCAAAATGAAGCTGCGGACGTGGAGGAatcgtcgtccagctcgtcgggGCTTCTTTCCGAGGAGCGCCAGACGGCATAGGGAGAG
TCTATAGGCACCTATTTATTTGCAATGTAATCCAAACTTGTGGGTCTCCTATCCGGTGGTtagtcgctgctgccataCTCGAGCCGCACGTGCGAGGAAG
TGCTGCGGCGAGGAGTGGCAGGTTGCCATCCGCACAGAATAGCCTCGATGTCCTGGAGACTACGCCTGCTGGTTTCGGGAACGTACCACCAGGACAAGAC
AACTCCGGCGATGTTGCACGCCATGACGATACTGACGCAGATGCCAAACACGGACACTGGGTTTGGCATGAACTCGCGGAGCGCCGGCAGTGCGTGTGCG
AGACCAATATTTACAATCGCTTCCCAGATCATCACGAGACTGACAGCGCCCATGCGCTGCTTCACGGCAAAAAGTTCGCTAACCATGATCACGGGCACAA
CACCGAGGCCGAGCTGGTGCCCGGCATTGACCAACAACATGGCAGCCCAGCCTGAATCGCTTAGCGccacgccgtcgtcttccgcTTGCTGCGCATTTCT
CGAGATGGACACCAATAGAAAAGCACAAGCCAATGCCACCAAGTAACATCCAcactgcagcgccgcaagcCGTCCTCTCATATCAACAAAGTAGAAGCAC
GCTACTACACCCATCGCGGCAGCTACTGCAACAGCCATGGTCACGGCAATCAAACCTTCTTCAGCGCCTTCAACCGCAACACCGAAAATCGTGAGGACGA
ATGAGACGTTGGAGTGGGTTCCTCCAACACCCCTGCTACCAGATTCAACAAGCGTCGATGTAATCGCTGGCTCAAGCAGGAAACAACTCACAGCACGCAA
CGTAAAGAGCGCGGCGCAAAGAAGTACGGGGCGAAAGAATGCGCCGTGGTGGCGCCGCTCCGTCGCTGCCAGCACCTTTGCATGAATAATAGCATTGGTC
TCATCCTCCGC