Description :
From Genome Similarity Track
Location :
scaffold_81:13247- 16175
Transcript NameFunction/comments
g2990.t1 tRNA (cytosine-5-)-methyltransferase NSUN2-like protein
g2991.t1 conserved hypothetical protein

Sequence
2928 bases(100 bases per row)
GGTGGGGAACATCGTGCTCCAATTGTAGAGGAGTATCTGTGCCCTGCTTCTCCTGCTAGCGCGGGTATTGAGACCAGCTCGAGTGCTACAAGCCTTCTGG
TTGTGAATGAACGTGATGCCACGGCTGCTGCTTCCGCTGTGCGGAGTTTGACGCGCACGCTGCCTCTTTCGCGCGAACTCGTCGTAACGGCGCATAAGCC
AGAGGAATTCCCTGTCCCGGAGACTACCGACGCTTTATTTGACCGTGTGGTTTGTTGTGCTCCGTGCTCTGGAGATGGCCTGGTTCGGAAGCTCCCGGAG
AAGTGGCGTACGTGGAGTCCCGAGCAGGCGTTGGTTCACCACCCAAGTCAACTTGGTCTGGCTGAGCATGCGCTTACTCTCCTGCAGACTGGTGGCTCTC
TGTTGTACAGCACACGGTCTTTAAATCCGATTGAGGACGAGGCTGTGATAGCTGAGTTGCTTCGTCGCTCAAAGGGTGCGCTAGAGCTCATAGAGACTGA
TGACATTCTGGATGGACTGGAGCGCTCGCACGGGCTAACGCAATGGGATGTTCTCGACTTGGCTTCGTGGGATGACTCTCCTGAGGACCAGAGACATCGT
CTCCGTCTGTCTATGTGGCCCCCAACAGCGGAAGAACGTGATGATATGCATCTAGAGCGCTGCGTCCGCATCCTGCCCCACCAGAACGACACTCACGGCC
TATTTCTCGCTGTCATTCGCAAGGTTCGCGAGTCAGAAACTATTGCTGTAGCTGTGGGGCCTTCACTGCCCAAGACAAAGGCGTCTACAGCACCTAAGAA
CAAGAAACAGGCGAAGGCTGAGAAGCCTTTTGGCAGCTTCACAGCTATCGACCAGAAGCACCTGCAGTCGATCCGGTCCTTCTTCGCTCTACGCAGCAAC
TCGGCTTTCTTGGAGAGGGCCGGTATGGCTCGCCAGAAACGTGCAGTGCATGCGGTGACGCCTGCAGTGGCAGAGCTTGTGACTAGCCAGCTTCGTGGAC
GTTTAAGTATCTATCACGCCGGTGTGTTTGCGCTGAGACCAGGTACCGGCGTTGAGGCGGTTGCTGATGAGCTTACCGACGATGGTGCTCGAGCGTTATT
GCCGGAGATGAACGCCCGGGTATTGAGTTTGCCGCAAGATGAGTTCGCTTCTTTCCTGCAGTCGCGCGAGATGTGGCTCAAGGATGCTGGTGAACACGCA
CGTGAACAGCTAGGGGATATGACCGAGGGTAGCCTTGCAGTCGCTCTGGACGACATGGAGCCTGCGCAAACGGGTGACCGAGACATTGTGTTGGTTGCCG
TGAAGCGACACAGCTCTTGCTCAATCGTGTCATCTCCTGCAGCGATCGCACGTATCAAGGCACTTCTAGAGGAGCTGAACGATGCTGGTGGCGACGGTGA
GGACGGCTACGACTCGTTTGAGTTCGAAGACGAGTAGATGACAGGTAAACTCTAGATAGAACAAGACAACTTTTTCAATGAACATACTGCTCTCACTATT
TAACCTTCGTCCAAACTAGTTTACTTGCCAACGTGCTGGGAAATGTACTCCAGAACAGTATTCGCTTCTTCAGCAACACCAACGCCATGCGACTGGAACG
GCATCTCGGAGTATTCAGGGTTCACACGGACAAGTTGCACTCCGTCGGTGTATGCGATGCGCTCGTTGGGTAGGCGAATCACACCAGGGGTGTTAAACCC
AGCGCCAACCTCAAGGATCGCGAGCTTCTTGCCTTCGTTTCGCACGCGGTCCAGCACCCCAGCAAGCCACTTGTCGTACACAGCACGACCTCCTTCCAGC
GCGCTCTGCAAGAACGAGTCATCCACACGCAGGAGAAGGAACATCCTACCACCACATTTGGGGCACTTTGGAATTCCAGCGGGGTCTTCGATCCTGTACG
TCTTTGGATTGAAGCTCTCCAGCGCTTTCTCCATGAACGGACGAGAACTCCAAACACTGTCTTCACTACAAGGCTTGGTGCACTGGATGCGACCGTAATC
GCCCTGCATGAGGTAGATAGACTTGCTATCGAAGCCTTCCTGCTCGAACATGCCGTCCGCGTTGCTGGTCTTGATGAATGCAGAGCCAGGTTTGCGGTTT
TCAAAGCTGTTGAAGATGTTCTTCACGTAGTCGTACGTTGGAGCCGTGCGGTGCCGCACCCAGTCGAATCGGGCAGTGCTAATCTGCTTGAAGAGGTATC
CCCACATGAGCGGTTCGTCCCATTTCGTGTATCCGATCGAGCTGTACATCATACGGAAACTCGGGATAATCTTCCTGATTCCAGGGTGGAATTTCTGCAT
CACTGCTTCGGACGTGTAGTCAAGACCAGCAGCAGCCGAAAGCCCAGCGCCAGCAGACACCAACAGGTAATCAGCATCTTGGACAGCTCGAAGTGCGCTC
TGCAGTGCCGTAGAAACTGGAGCAGAAGGTAAAACCACGCTATCCGGACACTTGCTCTCGATGTAGTCCTTGTACAGATCGTAGTCGCGCTTCAAAAACG
TGTTGAAGATCACTCTCCACCCACGACTCTCCTCTTTGTGCGCTGCCAGCCACTCCAGCACAGCCTCAACAGCAAGTGGCACAGCTAAATCGCTCGGGAA
AGCAAACAAACCGGTGGAAATGCACGGGAACGCGATCGACACTTGCTCTTCTGTGTGTCCAACCTCCTTCAGCAACAAATCCAGCGACTTGGTGTAGCAT
GACTGCAGTTGCTCCCGTTCTGCAGCAGTAGGTTGCGAGCCATGGCGCAATTGAGGACCGACCGTATGAACCACGTAGGAAGCCGGTAGAGCAAAGCCTG
AAGTGATCTGAGCGTTGCCCACTGGTTCTTCATGTGCCTGACGAGACATGATCTCGTGACAAGCAGTACGCAGACGAGGTCCGGCCATACTGTGGATCAC
ATTGTCGATGCACTTGTGTGATGGCTGG