Description :
From Genome Similarity Track
Location :
Scaffold_74:132466- 134139
Transcript NameFunction/comments
Physo_120283PREDICTED: similar to WD repeat domain 10 isoform 7

Sequence
1673 bases(100 bases per row)
ACATGGACACCGCTCGCTACCATCCCGTACTTGGAACCGCCTAAAGGACCTCTTCTCGTCCGAGGGGAATGTTCCCAAACAATGTAGTGAGTCGGGGACG
AGGTCCTGATACATGCAGCATCTTCAATACCGGGACGGTGACCAGTTCAACCACTCCATGCCTGCACAACTCAACGCATGTAAGCAGCTAGCCTTCACAA
GCAGCTCCGGGGTAATACGGCCTCTTGATCCTGACAAAATTCCCTGAAGTCTGGCCACCTGAATTCTCAAGAAATGCTTCAACTTGGACTTCCAGTACTC
GCTTTCCGTGCTCCAAACCATCGTCATCAGCCTGGGGTGCTTCACAGGCAAGCTGTCAAAGATAGTGATCGACAACACAGGCAAAAATCTAACGTTATAA
TACTCTGTTCCAGTCCTGGGAGACCGACCGATCGAGTCAACGGCTTTTCAAGATCTACGATCCACCACGTGCGACTTTTCATTGCGCGTCCCTCCTGCTG
GAGCTGCGCAGCAGACCCGTCACTAGAGCATCGATATCCACGTCCTGTCAAGGCCCAGCGCGGGGACTAATTGATTGCCCATGCGGAGTGTGTTGGCGTG
GAGCGACAAAGTGCCCGAGCGCAACGGGGAGAAGTTCGTGGTGCAGGATTTGGCCTTCCGACCGGACGGGACTCAAGTCGTCGCTGCTGTGGGCACCCGC
GTGCTGGTGTACGACGCCGTGGACGGCACGTTGCTGCACTCGCTCAAGGGCCACAAGGGGACGGTCTACGCCGTGGACTACTCGCACGACGGCAAGCGGT
TCGCCTCGGGTGGGGCGGACAACATCGTCATCATCTGGACGGACAAGGCCGAGGGTATCCTCAAGTACACGCACAACGACAGCATCCAGAAGCTGGCCTA
CAACCCGCAGTCGCAGTGTCTGGCGAGCTGCACGGCGTCCGACTTCGGGCTCTGGGCCCCGGAGCAAAAGTCCGTGGCCAAGCACAAGGTGGTGGCCAAG
ATCCTGTCGGCCTGCTGGAGCAAAGACGGCCAGTTGCTGGCCCTCGGTCTGCTCAATGGCAACGTGACCCTGCGCGACAAGCTCGGAGCCGAGAAGAGAC
TCATCGAGCGCTCGAATGCGCCCGTGTGGGCGTTGGCCTGGAGTCCAGCGCACGAGGATGACTCGACGGATATTCTGGCCGTCGGGTGCTGGGACCGAAC
CCTCGCGTTCTACACCCCCAGCGGAGTTATGCAAGGCAAAGCGCGCAAACTCGCGTTTAACCCCACGAGTCTCACGTACTTCAGGTTCGGAGGAGGTCTC
CGTGTCATTTTATGGTCGATGCGGCTCTAATGTGTTTTGTTTGATGATCTAGCAAGGGAAAGTATCTTCTCGTTGGTGGCAGCAATCGGAAGGCGGGACT
CTACACTAAGGACGGCATTTTTCTCGTCGGGTAGGACTCTAGCCAGGGAGATATTAACTGCAAGTGCTGCTAGTCTAAGGTTATTCATTGATTTGTACAG
AATTTGCGAGCAGGAGAGTTGGGTTTGGGCGATCAAGGCGCGGCCGAAGACGAATTTCGTGGGCGTGGGGAGTGAGGACGGCACGCTGTCGATGTACTGC
CTCGTGTTTGGCACCGTGCACGGCATCTACCAAGAGCGCTACGCCTACCGCGAGCATCTCACGGATGTGATCG