Description :
From Genome Similarity Track
Location :
Scaffold_13:1324598- 1328024
Transcript NameFunction/comments
Phypa_INRA-310PPTG_07986hypothetical protein
Phypa_INRA-310PPTG_07987hypothetical protein
Phypa_INRA-310PPTG_07988hypothetical protein

Sequence
3426 bases(100 bases per row)
CTTTTGGGGCAAATTCTGGTGGATGCCCAAGGCTCCAGCCGAAGGGAAGCGCTTCGGACTTGTGTACGGAAAGCCCATTACCACTAAGCACACTCCAAAC
CCGACCGCGGAACAAGTTCGTGCGGTTCATGCGAAATACGTGGCGGAAATCAAGCGGATCTTCGAGCAGTACAAGGCGCAATTCGGCTACGAGGATGACG
AGACCCTGGCTATCATCTAGCTTTGATCGAGCACTCTCAAAGAGGTACGCGTGGTATCAGGGTTCTCAAGCTCTTTTTCTTTGAATGAATGAGTGTTTGG
GCAAAAGTCACAGTTATCTTTTATAAAAAAAATGCGGTTCAGTCTACTGGTTTCTATGGGCTACCTGTTTGCTTGCCACCCTTGCAAGTGGCTTCAGTAA
ATACCATCATACGAAAGGAACAAGGAATTTTGTTGACAACAACCGAAATTTGACGAAGTTGCGCAAGGGGTTTGAGAAGACTCGACATGTCGACAAACAC
GGCAAGTGCCCCGAGATGTTGAATTGACGCAGCTTGGTCTTCTTACATTAAGGAACTGTTTTCTGATGAAGTTTCTTCAGCCTGGGGGTCTTCTAGAACA
CACTGACTATAAGTGACAGTCTTGACCTTGCACGAACTTCCATTCTCACAGTCGGTGGTCCAGCCAGACCCACCGCATTGTCCCCAAGGTTCGGCTACTT
CCTTGACACACAAACCATGATAATCGTCGTCATCCACGCAGATCAGATCATCTGCGCACGCGTTGCCACTGTCTTGAGGATCGCATTGCTGCCACTCGGC
TGACGGGTAGTCATGATCTCCAGTCGATTCGCACGAGGCCCATCCTTTATTTTGGCGCGAACACGTAGTCCCGTTCACGCAACTCACATTCCAGCCCAGC
CCTCCACACTGACCCGACTCCTCCACAACTTTCAAGTAGCAGAGGCCAAAGTGCTCGACGTCCGGCACACAAGCGAGTCCTTTATCACATTCAATTTCGG
TACCATTCTGCGACCGACATTGTTCCCACATTCCAGGCGCAGCATTTGAGACACCGATCCCGATCGTCGTTAGTGTGTAAAGCTTCATTGTTGAGAACCG
CCTGGGGGACACGTTCAGCCCGTGCAAGTTGGCAAATACTTCTCGCATTATCGTCCTTATTTTGGTCTCAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACACTCGGCGAGTCCAAAGCATTTAACGACATATTAGTCAACAGG
TTTGTTATCTTTCATAAAAAGAGGTTGGGGAGTTCACTATCCACTACGAGCTTTGGAAAGTTCTTTCCAGCTCGCCAAGATCGAAACTGTAGTCCGCCTA
CGCGTCCATAGCTTTGGACACGGCTTCGGGCAGGCACTGGCTGTAGAAGGTGTCGGACTCGCGGCAAAGTGCGCCCTTGGGGCATGAAGCCTTCCAAAGG
CCGCGGATCTCCTGGCCAGCGCATTGGTCGTACAGATCAGCTTCCTTCTTCATGCAGTTGCCAGACCACTCGCTATCCTCAACGCACTGCAGACCAGACG
CGCAGCTCTTCGTGCCATCCTCGAACTTGCAGCGTTCATTGAGCGCCACCTTCTCCTCCCCCTCCTCCTCTTTGCGGTGGTTAGGCATCTTGATTTTTTC
ACGGTCGGTCTTCTTCTGGCACTTGCTGTATTGGTCCGAGATGAGAACGCACTTGAGGTTGCTGCCACTGCAGGGCACAGACCAGGGGCCAGCGGTGCCC
TTGCCACCGCACTGGTCGTTGAGTCCCGGGTTCTTCTTCATGCACCAGCCAAAGTGCTTCTCCTTCATCTGGCAGAACATGCCAGTGTCGCACTTGACGG
CCTTGTTCTCCCATTCACACTGCTGGTACAGTCCCGCCTTCTCGGTCAGGATGTGGACACGCAGGTGCAGCGAAGCGTCCGCAGCGGGGGAGGCGGCTAG
GCCCAACAGAGCAGCGACGAACACGGAGAGTTTCATGGTGCCAGCGAGGATACTTTTGGTGTTAGATGGTCAAATGCAGAATGGACGGTACGCTATCAGC
GGCGGCAAGCGTCATGCTGCATGGACGAGTTCGAGAGGCACGCTAGCAGCCATGCAGCTGAGTTGCTGGTCACTTTGTCCTATGAGTCAAGGAAGTACGC
CAAAACTGTAATCGAGTCTGATACGGACTTACTCTCACGGGTTATGACTGATACGAGAGCTTTTACACAATCAGAAAGAAAATCAACAATAGGATCCTAT
AGGGTATTAACTGTAGAAGGCTTTTGCAAATCATGATATTTATGTTTCTAAACCTCGATTAAACTTCGTGTACGTGGTTAGAAATGGATACGTTTCTATG
AACTTCAACTTGTCATTTGAGCGTGG