Description :
From Genome Similarity Track
Location :
Scaffold_13:1324570- 1328024
Transcript NameFunction/comments
Phypa_INRA-310PPTG_07986hypothetical protein
Phypa_INRA-310PPTG_07987hypothetical protein
Phypa_INRA-310PPTG_07988hypothetical protein

Sequence
3454 bases(100 bases per row)
GAAAGATACTCGGCATCCCGGTGCTTATCTTTTGGGGCAAATTCTGGTGGATGCCCAAGGCTCCAGCCGAAGGGAAGCGCTTCGGACTTGTGTACGGAAA
GCCCATTACCACTAAGCACACTCCAAACCCGACCGCGGAACAAGTTCGTGCGGTTCATGCGAAATACGTGGCGGAAATCAAGCGGATCTTCGAGCAGTAC
AAGGCGCAATTCGGCTACGAGGATGACGAGACCCTGGCTATCATCTAGCTTTGATCGAGCACTCTCAAAGAGGTACGCGTGGTATCAGGGTTCTCAAGCT
CTTTTTCTTTGAATGAATGAGTGTTTGGGCAAAAGTCACAGTTATCTTTTATAAAAAAAATGCGGTTCAGTCTACTGGTTTCTATGGGCTACCTGTTTGC
TTGCCACCCTTGCAAGTGGCTTCAGTAAATACCATCATACGAAAGGAACAAGGAATTTTGTTGACAACAACCGAAATTTGACGAAGTTGCGCAAGGGGTT
TGAGAAGACTCGACATGTCGACAAACACGGCAAGTGCCCCGAGATGTTGAATTGACGCAGCTTGGTCTTCTTACATTAAGGAACTGTTTTCTGATGAAGT
TTCTTCAGCCTGGGGGTCTTCTAGAACACACTGACTATAAGTGACAGTCTTGACCTTGCACGAACTTCCATTCTCACAGTCGGTGGTCCAGCCAGACCCA
CCGCATTGTCCCCAAGGTTCGGCTACTTCCTTGACACACAAACCATGATAATCGTCGTCATCCACGCAGATCAGATCATCTGCGCACGCGTTGCCACTGT
CTTGAGGATCGCATTGCTGCCACTCGGCTGACGGGTAGTCATGATCTCCAGTCGATTCGCACGAGGCCCATCCTTTATTTTGGCGCGAACACGTAGTCCC
GTTCACGCAACTCACATTCCAGCCCAGCCCTCCACACTGACCCGACTCCTCCACAACTTTCAAGTAGCAGAGGCCAAAGTGCTCGACGTCCGGCACACAA
GCGAGTCCTTTATCACATTCAATTTCGGTACCATTCTGCGACCGACATTGTTCCCACATTCCAGGCGCAGCATTTGAGACACCGATCCCGATCGTCGTTA
GTGTGTAAAGCTTCATTGTTGAGAACCGCCTGGGGGACACGTTCAGCCCGTGCAAGTTGGCAAATACTTCTCGCATTATCGTCCTTATTTTGGTCTCAGC
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACACTCGGCGAGTCCAA
AGCATTTAACGACATATTAGTCAACAGGTTTGTTATCTTTCATAAAAAGAGGTTGGGGAGTTCACTATCCACTACGAGCTTTGGAAAGTTCTTTCCAGCT
CGCCAAGATCGAAACTGTAGTCCGCCTACGCGTCCATAGCTTTGGACACGGCTTCGGGCAGGCACTGGCTGTAGAAGGTGTCGGACTCGCGGCAAAGTGC
GCCCTTGGGGCATGAAGCCTTCCAAAGGCCGCGGATCTCCTGGCCAGCGCATTGGTCGTACAGATCAGCTTCCTTCTTCATGCAGTTGCCAGACCACTCG
CTATCCTCAACGCACTGCAGACCAGACGCGCAGCTCTTCGTGCCATCCTCGAACTTGCAGCGTTCATTGAGCGCCACCTTCTCCTCCCCCTCCTCCTCTT
TGCGGTGGTTAGGCATCTTGATTTTTTCACGGTCGGTCTTCTTCTGGCACTTGCTGTATTGGTCCGAGATGAGAACGCACTTGAGGTTGCTGCCACTGCA
GGGCACAGACCAGGGGCCAGCGGTGCCCTTGCCACCGCACTGGTCGTTGAGTCCCGGGTTCTTCTTCATGCACCAGCCAAAGTGCTTCTCCTTCATCTGG
CAGAACATGCCAGTGTCGCACTTGACGGCCTTGTTCTCCCATTCACACTGCTGGTACAGTCCCGCCTTCTCGGTCAGGATGTGGACACGCAGGTGCAGCG
AAGCGTCCGCAGCGGGGGAGGCGGCTAGGCCCAACAGAGCAGCGACGAACACGGAGAGTTTCATGGTGCCAGCGAGGATACTTTTGGTGTTAGATGGTCA
AATGCAGAATGGACGGTACGCTATCAGCGGCGGCAAGCGTCATGCTGCATGGACGAGTTCGAGAGGCACGCTAGCAGCCATGCAGCTGAGTTGCTGGTCA
CTTTGTCCTATGAGTCAAGGAAGTACGCCAAAACTGTAATCGAGTCTGATACGGACTTACTCTCACGGGTTATGACTGATACGAGAGCTTTTACACAATC
AGAAAGAAAATCAACAATAGGATCCTATAGGGTATTAACTGTAGAAGGCTTTTGCAAATCATGATATTTATGTTTCTAAACCTCGATTAAACTTCGTGTA
CGTGGTTAGAAATGGATACGTTTCTATGAACTTCAACTTGTCATTTGAGCGTGG