Description :
From Genome Similarity Track
Location :
Scaffold_140:13241- 15924
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_140-abinit-gene-0.31Ran GTPase-activating protein 1
Pytar_ATCC12531maker-par_contig_140-fgenesh-gene-0.6GTPase

Sequence
2683 bases(100 bases per row)
TGCTTCCGCGTGTCGCTGTGGGACGTCGGCAGCGTCGACGCCGACTCGCGCCACCATCGGCTCGTCGTAGCACCCGTAGGTACTGCTGGCTCCGTCGCCC
AGCCTCCTCCTCCGGGTTTTTGCTCGGCCTTGAGCGGCAGCGAGAACATGGATGTCGCCGGTGGGACACTGGCAGAAGACCCCTTGGCTGTCGTTAGGCT
CACAGCGTTTCTCGGCACGTGCTGGTCAAAGAAGCGGTGCTGCAGCGCCTGCGCGGCCGTGAGCCGGCGGCTTGGATCGTACTGCACGAGCTCGCTGATG
AGCTGCACGGCGGCCTTGCTCGTGTACGCCGGGAGCACGTGGGTCCACTGCACGGGCGCACACTTGGGGAACTTGAACTGCATCTGTGCGAGCGTCGTCG
TGGCCTCGGGCCAGTTGTCCTTGGTGGGCGAGCCCAGCACACGGGCGATGCGGCAGAGCTGGTCGGCCTCGGACGAGCCGGCAAAGAGCGGCGTCTGCAG
AAAGAGCTCGGCCATGATGCAGCCACAGGCCCAGAGATCGATCGGGCTGTTGTAGGTCGTGGTCCGCAGCAAGAGCTCGGGGCTGCGGTACCAGCGGGTC
GAGACATAGTCGGTGAAGGNNNNNNNNNNNCCGCGCGCGGATCTCGCGGGCCTGGCCCAGGTCGGCGATCTTGAGCGTCTCGTCGTGGCACAGCAGATTC
TCGGGCTTAATGTCGCGGTGGAAAAAGCCGTGCTTGTGCATGTAGGCGAGGCCTGACAAGAGCTGGAACATGATGGACTTGATCTGTGGCTCGGTGAGCC
AGCCCGCGGGCAGCTGCGTTGGGGACATATCCTCAGCTGACGATGATGCCGCCAGTCGCTGGTGATGCCGCAGGACCTTGTGGAGCGACGACTGCATGTA
CTCAAAGACAAAGTAGAGCTCCTCCTTGTCGCGGATCACTTCCTTGAGCTGCACGACGTTTTCGTGGCGCAAAACGCGCAGCGACTTGAGCTCGCGCAGC
TGGAGACACTCCTCCCACGTCGGGAACAGCGTCTTCATTTTCTTGATGGCCACGAGTTCCTTGGTCTTGAGGCTGCGCGCCTTCGTGACCTCGCCAAACG
AGCCATCGCCCAGCCGCTCCAGCAGCTCGTACCGGTTCATTTGCCTCTGGGCCTTGGGGTTCCCGTGCTGGAAGTGATGGCAGAGAGAGAGAGAGAGCCT
GGCTCTATAAATACAAGCGATAATCCCGCTCCATTTCAACATGCTTACTGGTCTTTCGTGAGCTTGCCATAGTTCTCCATCATCCAGCGCAGCGTGCGCG
CGACGCTGTCAATGTCGACCTTGTGCTTGGCGCTGATGGGCAGCACGGCCATGTCGGTGGCCTGGCGCAGCCGCAGCAAGTTCTGCTCGGCGCCGCGCGC
GTCCATCTTGTTGGCCACGAGCAGCGACGGTCGCGTCGTAATGTTGGGCGCGTACAGCTCGAGCTCGCGCTGCAAATGCGCCAAATCCGTGAGCGGGTCG
CGGCCTTCGGTGCCGGCCGTGTCGACCACGTACAAGAGGATCTTGGTGCGTTCAATGTGGCGCAAAAAGTCGTGGCCCAGGCCGACGTTGCGGTGGGCGC
CCTCAATGAGCCCGGGAATGTCAGCGACGCTGAGCCGGTACGTGTCGGGGAACTCGACAATGCCGACAAACGGGTGCAGCGTCGTGAACGGGTACGGCGC
AATCTCGGGCGTGGCGCGGCTCAGGCGACTGAGCAGCGTCGACTTGCCGGCGTTCGGGTACCCGACGAGCCCGACGTCGGCGATCGTCTTGAGCTCGAGC
TCAAAGTACTGCGATGTGCCGGGCGAGCCCGTGCCCTTGTTCTCGGGCATGTGCTTGCGCAGCCGCCCAAACGTCGTGGTCTTGCCCGCGAGAATGCGGT
TGCCCAGGCCGGGCTTGCCGCCCACGGCCGCCTGGAACTCGGCGCCGTCGTGATCCAGATCAAACACGGGCGTCAGGCGGTCCACGATCTCAACCTCGCC
CGACTCGAGGTCTCGCTCGTACTGTAGTAGTAAGAGAGAAAGTGAGCCAAGCAGATCACAGGGGGAGACTAGGTGAGAAAACAAACGTACTCGCTCAACG
CGCTTGATGATGGTGCCGCATGGCACTTTGACAATACAGTCCTTGCCACGGCGCCCGGCCGAGTCGTTGGCTGTTCAAGTAATATCAGTTAGCCTTTGCT
TTGTGGATAAGCCACTCAGGGACAAGAAGACGTACGCATGCCGTTGAGGCCGGCGCCGCCGCGAAAGTGGTGGGTCGCGTTCGCCAGGTTCTGCACGCGC
GCGTCGGCGCGGATAAACACATTGCCCCCCGCGNNNNNNNNNNNNNNNNNNNNNNNNCCGCCGTTGGGCCGCTTGCGCATGGCCGACTCGCTGAAAAAGC
TGCTGCAGCCGTTGCCGCCGTGACCGCCCGTGGCCTTGATCCGGATGCGGTCCACGAAGCGCCGCTTCGAGTGCGTCGCGCGGCGCACGCTCACCTTTTG
CTTGACGTGCTCCTGCACAGCGCCCTGCTCGCCAGCGGCGTCCCAGTCGTCCCATTCTTCGTCCACGTCGTTCAAATCGTCGTCGTCAAAGTCCTCATCG
TCGCTCCAGTCGACTTCGTTGTACTCGTCGTCGTCATCATCGTCGTCTCGCGACCGCGTGGAGAATGAGGCTCCAGCTGAGCG