Description :
From Genome Similarity Track
Location :
Scaffold_226:13241- 14492
Transcript NameFunction/comments
Albla_Nc14103400kinesinlike protein putative

Sequence
1251 bases(100 bases per row)
GCCTGCCCGTAGCTGTCTGATTATCGTCTTGAGCTTGTTCACTCGCTCGCTATCGGCGTTCTTGTTGGCGGTATTGGTGATCATTTTGACCCGAGATGCA
TACTGCAAGGAAGTTTGTGTTTCTTCCTGATTGTAGTCGGCCGGAGACACATTCACAAACATGAGCTACACACAACAAGTGACCGGGTGCCCGAGTACAC
AATTTCGATCAAATCGTACCGTTTTGGCATTTCCACCAAGAGAATCCTGCATCAATTGGGTCAGCTGTCCAGACTGTTAGTACCTCTACTTGGTCCATGC
ATTGGCACAAACCTTGTTGTTTCGGTACGGAATGAACTTTTCATTGCTCGACAACGCGGCGATGACATCTCCAAGCGCTAATCAAGGAGATTTTGGACTC
ATTCAGCAGGAGATGAAATTCGTACCGCTCAAACTCTTATTGATCGCCTGTGCCTCCTTCAATCGATCGGCTGTAGCACCGGTCTTCCCAGCTCGCTCAC
TCCCTGCCAAATCAACCAGGCTGATTTTCCCGGTTGTGGTGACCTTGGTCGATTTATGGGTTGCTCGGACGAGGATGGACAAGACCGAATGTGATCGGGA
GCTCTCAGCGTTCATTTTTGTGGCTCCAACTTGGCGTTTCAGGTTGGCTTGTTCAAAAAGCTTCAGCGTCTGCTGGGCCGAAGTGCATACTTTTATCGTG
GCATTTTGCACATACACCAAGCCTTTCTCATTCTTCTTGATATCGAGTTTATCGCTGGACGAATGGCCATCCACAAGTGCGAATAAATCGATCAGGGTAT
CGTTATATAGCTCAATCATGTACGCCTGGAGTGTGATGGTACACTGATCGTCCAGTTCAGCGATCCGCGAAAAGAGGTGGCGGATTGCTCGAGGGCTCAG
ACCCGGCAAAGCGTTATTTCCTGTCATGGTGAACGTCTTCCCGGAGCCTGTTTGGCCATATGCAAAGATGCAGACATTGTACCCGTCAATGGTGGATTGT
ATCAAGTGTTGGGTGTCCTCAAAGACTTGTTCTTGGGTGCTGTCAGCCGAGAAGACCTGATCAAATACAAATTCCTTGGTTCCTCGAGATGACTGCAGGG
AGATTGTCATGTCATTGGGGAAGGATACGCACACTTCACAATTCCGCTCGGATTCCGACTTGGACATTGGACGACATCGAGCAAACACACGGATTTTTCC
CTTCAGATCTTCGACCTGATTATAATACTTTTTGCGAAGTTTTTGCTCTTC