Description :
From Genome Similarity Track
Location :
Scaffold_245:1324- 4269
Sequence
2945 bases(100 bases per row)
TGAGAACCCTTGCGCTTCCGACATGAAGCTGTCGAAGTTGCTGTCTCCAGCTACAAAGGAAGAACGCGCTGAGATGAAGTCACGACCGTATCGTTCTTTG
ATCGGGTGTCTGATGTACATCACGACTTGTACGCGACCGGACATAGCATTCGTGGTGACGCAGTTGTCACGCTTCCTTGAGAACCCTGGAACGCAACATT
GGAAAGCGGTTATTCGCGTTCTTCGATACTTGAAGTCGGCTCGTGAGCACGGCATTGTGTACCACGGAGGTTCGGGAACGGTTATTGCCGAAGCATTTAC
GGACGCGGACTGGGGAAGTAACACTGATGATCGACGTTCCGTATCTAGAGTCATGGTACTGATCGGGAAAGCTCCTGTGGTGTTCAAGTCCAAGTACCAG
AGGACCGTCACTCTCAGTTCTGCGGAAGCCGAGTACATGGCTTTAAGCCTTTGTACGCAAGAGGTGCTTTGGGTGCGCGCCATGCTGAAGGACATGGGTC
GCGAGCAAGTGGGAGGAACGCGTGTCTGGGAAGACAACCAAGGTGCAATTGCATTGGCACGTAACGCTGGATATCACGCTCGGACGAACCACGTGGATAC
TCTCCAGCACTTCATTCGCGATAACGTGGACCGCGGAACACTCAAGGTCGACTACGTGGATACGAAAAACCAACTAGCGGACATGCTTACTAAGGGACTG
GGGACCAAGACGTTCAAGTTCCTGCGTCATGCAAGTGCAATCAAGAGCAAGGTCACCAAGCAGTAGCGGTGAGTGGGAGTGCTGATATTACACCGCTGAA
CAGGTATGTTTCATGTTGTTAGGATGGTGATTTATATGATAAATCATCAGGGAGTTTTATGGTAGTTTCAGAGGATTGCCATGGAACAGCGTTACATAAA
GGCTTAGAGATAGCTCATGGTAGTGAACTAAGGACCTTAAATATATTTACTTCGGCGTTTGCCTCCAACACAATAACCGACTACGTTAACAAAAATGCAT
CCGGTCACCCACTGCAACAAGAACGGCTACGTCGGCCGCTTACTTACCTTCAAAGATGCAATTAATTTTGACCAGAATGCACCACTGCTGAAGTCAAAGG
AACGTACGTACGACTACGAGTGCTTACCGGAAGACGTTGCCTAGCACAGCAAGAGCTACTACGAAGAAGCGAGCTGTAACACACTACCCATCACAACACA
GCGTCAATTCCACAGGACATATACACGCACCGATGCAATAAAACTGCAACATAAGAGGATGCTCGCTGGCTGGAAACCAACGATAAGGCTCCGCTTAGTA
CTAAACCATTCGGTTCGCTTCCAGCTTCCAGGATTTCCGAAGGCCGAGGCTGAGTGTTTGCATCCTATAAAAGAAGGGCGGATATACAGCATAATAGGAA
CGGCTCTCGCAGGATATTTCTTCATGTTTACTAGAGGCCGTTAGTGGTCGGTCTGAGTGCTACTTCATGTAAGGGATGGCTCAAGGAATGTAATACTTAA
CCAATTCCGGCACTCAGCCGAAAGACCTTCAGCACAACAATTACTTCCCTGTCATCTATGAGTGCCAACTAGACCGGATTGTCAACGAAGCCACTCCATG
AGCTCTCCACAAAGGTCGGACCATCATTTCTGCTCCACGCGGTAACAGACTAAGATGCTTTAACTGTAACAATGCAATGGACATCATACATCACACAACT
TAAGATCTTTAGTCCAACGTGACCGGGTGTCTGGCATACCAGGCTCGCTGGATCCATTCAGCGATGGGGCTCGGCAGCCCCTCCAATTCAAAAAGTGCAT
CCACGTAATTTTTGAAGTATGTACACTCAAGAATGTGAAGTACACCACCGTCACTGAAGTGGGAAACATCGGGAAAGAGGTGCTTTTCATTAAAGCGAGG
TACATACTGAAGCCACAGAATAAGCGTATGTTTGATCATCCAATCTCGTACGATATCCATCGTTTGCGCTGGAGGGGAGTTCACCACTGCTTCTAGTAAT
TGAATCATGACCTCATCAGGTAACACGTCATCTTCCAAAGATTCATTCAGCTGCTTGCGAACGGCATTCGGAATTCAGGAATTAGCGACGTGTGCAAGTC
GTAAGCGCGCATTAACATGCCAGGAAAATCTCTAAGATAAAGAAAAAACTCGTCCAGATCGAAACATGTTCTCCCTTTAATCAGCAGCGTCAACACATCA
GCATTGGTATACGCGGCAACCTCAGCGGAGTATCTGGCGGCATAATCTAGCTACTGCTTAAGCCCTTCGAGGATAGGAAGCTATTCCTCCTGGCCAGAAC
GGTCAGTCCAATAATCATTCTGCGCCGCGAGAGGCATCATATGGTATGCATCATCAGGGTGCACTCGTGTTAACAGCCATAAATTGTTCATCGGCCCCAA
CATAGAAGGATGTGCCACCGCTAGCTCCCTTTGTAAGTCGTCGTCGCCTTTTTTCATACCATTGACGCTTCGTACCGAACAGAGAAGCGCAGGCAGCTCT
TCCCAACTTGTTTTACTCTCCAGAGTCTTGACAGCATCATCTTCGTTATAGGTGTGATCATTCTGGTACATGTCAATATACTTCAGCCACCGAATAATTA
CCTCTCGCAGATAAGCTTGTCATTAGGCTCTTGCTAGTTCAAGTGATCGAAACGTCTGCTGGGTGTATATATTGCGAAATCCATTGAAGCGTGCGCACTG
CAAAAAATGTGTCGGACAGAAAAGAAAAGGGTTTAAAAATCACTCCTTATCGTTTCGCTGGACGTCGTCAGTCTTGTTTACGGAAGCGATGTAACGGGGT
TACACATCGAAGGGTACGCGGTACCCTGTGTCTTAGACGCACGGGATGGTATCCCACTGAAAGAGATATACAATATCTTAATCGGCTTATAGGGCTGCCA
GCCACGAGATAGGAAAGATCTCGAAAGTTCTTGGTTTAGGACATG