Description :
From Genome Similarity Track
Location :
Scaffold_676:1324- 2384
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_676-fgenesh-gene-0.0Transmembrane protein 184 homolog DDB_G0279555
Pytir_DAOMBR486fgenesh_masked-pir_contig_676-abinit-gene-0.32Condensin complex subunit 2

Sequence
1060 bases(100 bases per row)
TCCTGCTATCCTAACGATACAAGTGTATGGGAATCAGATCATGCGCTCACTGCCGGACCTGCCGCACCCGTACCCGTTCAACAAGTGGTGCACGCCGATC
AAGATGGGTCCCGAGTTCATCCGCGACTGCAAGATGGCGACCATGCAGTTCGTGGCGATCAAGCCGCTCATGTCTTTCTTGGCGATTGTGCTCGAGGTCA
ACGGTATGTACAACCAGGGCAGCTTCAGCGTCAAGACCGGGTACCTCTACACGAGTCTGATCGTGAACACGTCCATCTCGTACGCGTTCTACTACCTCGT
GCTCTTCTACCTGGCGCTCAGCGACCAGCTCAAGCCGTACAACCCGGTCCCAAAGTTCCTCTGCATCAAGGCGGTGCTCTTCCTCTCGTTCTGGCAGAGC
GTCGTGCTTGCGTTCCTCTCGCGGTTCCAGATCATCCACGAAGTCGGTTCGTGGAGTGTCGAGAACGTCACCACGGGCATCCAGAACCTGCTCATCTGCT
TCGAGATGTGCTTCGTCGCGCTCGCGCACCACCGCGCATTCCCGTATGCGCCATATGTGCGAGTCGATGGGGGCGACGACGATAGGAACACACACGCGTC
GCTGCGCAGAAACATTCTCTCAGATAACCTCGCGTTTGGCGACGCCATGCGGGACTTCAACGAGGTGATGCCCGTCGTGCTGCCGACGCATTTCAAGCCC
GGTGCATCGATCCTCAAGGCGAAGAGGAACTTGACCCAGGTCGCATCGCAAGATCTCTTCGCCGCCGAGAACGCGAGGCTCTTGAACGCCGAGCACGAGG
CAGCAGACGAGAGAGATTCTGGCGCTGCCAAACGCGGTTGGAAGCTTTGAGGAAAAAGTTGTCGCGATGCTACGTGGAAAACTCAAATCCAGCGCATGTG
CGAAAGACAATCGACGCCACACACCTTATCTATTTTGAACAGCCATTTAATCCTTTCCTGCTTTTGAATCCAGTACCATTTTCTGATTTGCCTTTGCCTT
CGCTTTCGCCACGAGAAATACGCGTGACGCTTTATTCGTCCTGTTCTTTTCGAATCTTGA