Description :
From Genome Similarity Track
Location :
Scaffold_92:132387- 137679
Sequence
5292 bases(100 bases per row)
TCCTGGTTCAGGGAACTAATGACTCCTAGGAATCACGTGGCACCAATGCCCAAGATTACTAGCCTTAATACAGGCTCTTAACTCTTACGACCAAAGACGT
CTTCGAAAGACACGTGTCTGAAACTGCTTAATAGAGGATCTGAATGTATTTACTGAATTATAGCGATAATAAATCTCACTTACGTATTTAACCTTGAAAC
TATACTACCCAATCGTTTAGTCCTCATGGGGGTTCTTCTTGTGTTACCACACCAGAACTACGCCGTACTTTGAATACCCTATTACGATAGATACCATCTA
CCCGTAATCAATAAGGTACGGTATTACCGCTAGCATATGTGATACAATAATACGCCTATCGGTTTCACTGATCTCATTATGTGTGTATCATACCAGCGTA
CCTGGCTATCACAACCGTTTGTGTAGCCCTTTAACGCCTCCCCCCACCAGACAGTCGATACTTCGAATCGACATTCTTCACCTCTTTCATTGAGATAGCT
CGGAGATAACAGATAACCTCACGGTTGTGTTCACGGCACCTTACGCATCAATGGAGAAGTCTTTGCATTCCTCTGAATATCTGGAAGACATACTGCTAGA
AGAGAACATCGTCGATTATGATAGTGACAATGTCGCGATGGGCCTGACACGTCAGCGTCGCTCGAGCACTCGCGCATAGCGCCGAAACCATTTTCTGAAC
GAATTAAATCTCAAGCGCTCACATCGTTGCGTGCCGCAACTACTCTTGATGATCAAAATCATCACCAACAAGCTTGATGGGCAACAACAGCAGTTTATCA
ATGAGTATGAGAGGGCTAGACGTCTATCTCAGACATTAGCTATTACAAAGGCGCGTTCAGACTATCGCTTTAAGCCTTTAGGCGTTGCTGAGTTGTTGCG
AAAGTTCGCAGGGCAACCCTTGACCACATGACCCACAGGGCGTGAGGCCACGACGTCTAACGACAATTCCGAGCGAGATGCTCTCAGAGAGATACCTAAC
GCCAGAAACGACAACGATCTCCGAGTACCAGGCCAAGTTGGCGGAACAAGCACGTGGTGCCTCTGTACCCACGCAGAGAATAGTCTCGATCTTGAATTGG
CCGGGTCTATCTTGACCTCGAAAAACTTTGGTAAACCTCACGAAGACCAAGTCTATCCATGAGGGATCGGGTTCTACCAAAGAAGGACCGTGGTACACCA
TGAGAGACCAGGTCTTCCCATGATGAATCAGGGTCTACCCCTAGGACTTTCGAGACGAGACTCTAGTTTTCATGACTATGCGTTGCTTCGAACCGATTAC
GACTCTTCTGCTTACATTCTAACTCTCGCAGTAAGGATACACAATTCAAATCAAGTTCACCTACCCATGAGGGGTCCACATACCCCTTCGAACGAACGAG
CAATTCTCGTTGCCGTCGCCCATAACGCGTATTCTTATCAGTACGGATTTCCAGAGTCTCTTCGACTTCGCATTCGCCTTTCATCAATTTCGTACTTATA
TGTCTTCCTGCAATAAGCATTCGACAAAGTCGAACCGGTCTGCCTGGACCACTGTTACTTAGTTGTTTGGTCGATCAGGGAATTTAGTAACCCGCTTAAG
CTTGGATATGCGTACGATCGGAAACAACCTGTATTCCGTACCACGGGTTTCTAAAGGTACTGCGTGGTCTCCCACCAGCTCCAGAAAGCGGAAACGTCCA
TGCGAAAGGGGGGGCAGTTTCCTGGGATATCCTTCTTTGAATCGGTCGAGATAGAGCCATACTTGGTTCCCCGGTCGAATCTTGTGGTCAACCACTCCTT
CGTTGTGTATTTTCCCTCGCTTCTGACTCTCCTCCCGCATTTTCTCATTCGCCTGTTCTCTCGATCGCTGTTACTGACTCTGAATGCGGTACCTCCAACT
TCTGGGCTCAAATCTTGACGACGGACATTCACTATGGGTAACGTGGATTCAAGGGTGGACCTGGCATCCCAACCGTAAACCAAGTAAAATGCGTTTCCTT
ACGTACCAATCTTGTGCGGTATTGATCGAAAACTTCAACTGCTCCGTATACTTGTCCCAGTCCCGTTGCCCTAAGTCAACGACATACAACTTGATAGACC
TGGTCAGAGTCAGGACCATCCTTTCTGCCGTGTCGTTGGCCTGAGGTCGGTAGGCCGTTGTCGCTTGCTGACGTTGGCCCACAATACGATTTAACGCTCG
GAAGAAATCCGACTTAAACCCCGGTTCTCGATCATGACGGATCGGCTCGCTATCCTCGAAACGGCGGAAACACACTCTTCATATCCCTCATCTACCATCT
GAGCTGTCCGCGAAGAGCTAGCCTTGACCATTAAGTATCCGGTAAATGAATTAACCCATATCTGCAGTTCTGTATTTCTTTATGTGACATTAGAAGATAC
GGAATATGTTATATCGCTGTAGTTTGGAAGGGGTCGGTCGCCTCGATATTCACAGGGCTCTTCCTTTTAGTGTAGGTCCACCTTATTCGGTCTCAAGATC
CATGCAGGAACCCACATATCTCCGCACACTTCGAAACCGACCCTTTTAGTGACAGTACCGTCGTATGCGTTGGTAATTACGCCCGTTACTTGATGGCCCT
CTTCTTAACTCGTGTGGTAGTAGTGGCGAAAGTCGGTTTGTAGACTTTCAGGTATCACCAGCCTGACTATCATAACACGACCTTCTCCCTCGGCTCTGAA
GTTGAAGCAGTACACCAATAATCCCTCTTTGCTTAAATCGTAATTTCCTGACATGCAGCTGCACGATTTAGCAGATTCCACAGACAGGTCACTCCAGTCT
TTCTTCATATAAGCTTTCAAATATCGTACCCAGCTCTTTTCTTCTTGCCTCTTTCAAATTCGGTCCACTCGGAGTCGTTGTACCACCTCCTCTTGCATGA
TCTTTCCAGATATCCTAATCGGGCAGCGCGACCGAATCACCGCATATATTTTTGTAGAGGAGATATGGTCTTCAGGGACTACTAACTCCGATAGACGGTT
GATCGCTTCCAAACCTGATCTTTCTTCACTCGGCGTCGACTTGACCCCCTCCTGCTTGTGCAAAGCTGTAACCAACTGGTTCGCGCTCTGGTTCCAATCT
CGTTTCACATGTAGGGTCCCATGGGATGGCCACGGCTGGAGTTTATTTAAAGTCCGGGATCGTAGTGGGGACAGGACCGAGGCTTTACACTCAATCTCCC
CCCGTATCTGACGCAACACTAAATGAGAGTCTCCACAGATAATTAATCGCCGCCTCTCTAAAGATTTCAGCAGGTTAAATCCCAGCAACATACCTTCATA
TTCTGCCTCAGTTACCGTAGATGTGTCGAGGTACTTGGAAACGGCTTCGACTATAGTCCATGCTGTAAGTCTCCATACTATAGCGCTGCATACCCCACCT
CTTTTTTACACGGGATGACCCATCAAAACTCATTTTATACAGTTCTTCATCAATTTCCACGGTGGGGGTAGGTAGGTCAATGTTTGCCTTGCCTGCTTCT
TAGGAGAAATAGCCGACAAAATAAGTATACACTCTCTCGAGGTGTAATACTAGCTGTCAATGCCCCTATAACCTGGTCTTTGCTTTTTTACACTCCACGA
TCTCTAAAGTCCGCTGGGAAGAGAGGGCGGCCCAGTTTCCCAATCGCTCCTAGAAAACGGCACATTTTACTAACCATGCCAATGCCGAATGTCTTGTCAA
GACTTTGAGAGTCCGGGTGACCAACATGGTAAAACAGGTCTCTAATATACGCAACAAGGCTAACACGTATTTTTCCACGGTACTGTAATCGAGTCCATTA
GCCTTGAGGGTATGGATTGTAAAAGTCACCGGCATAATTATTCCTCCGGGATCTTGTACTAGTGACACCGAAATGGACCGTTCACTCGCATAGACAATAA
TCACTGCCTCTCTGGTCGGGTCTAAGCGTCTCAGAATTAGTGTCGTGACAATCTTATTCTTAAGTATAGCGACTGATACTTGAACACGGTTCTACCTTTC
TTCGTTTTCATCCTTGGTGGTAGTATTTTGTCATCCCTCTCCAACTGGCTTCGTTGTGCATGGAAACTCATCTCACTTAGTTCGTAGAGAATGGACGCAT
ACACGGCATAGTCCTCAATAAAACTGTTATAATAATTCAATCTTCCCAGAAAAGATTGCATGTTTCTCGGTATCATCGTTAAGGTAGGTCAATCAGAAAT
TGGAGGTCCTTAGGGTGAGCCTCCAGTACCCCACTAGACACTCGATGTCTACGGTAGTCGACCTTCCGACACTCCCACGAACACTTGACTGCGCTGATCG
ACAAATTCCAGTAGTCGCACACATCTAACAACCGTTCCACCTTGTACACAACGCATCCCATGATTCAGCGGGAATTAGAATGTCATTTATATATGACCGT
AGACCCAGGGTCGGGGAACCCGACTGCGCATCTGGTTATCCCACCTTGAACATATCTTTCGACCCTTCTGTCTCTGCTCCTGGAGAAATTCGTACTAACC
CATATAAAGCGTTATCCAAGGGTCGCTGACATATTTAAGGTGCATTCTTGAGCACGAATAACGTCCGCAGCTATTCAAAAATCCCAGTGGGGTAATGAAA
GCCGGAATTCGTCTCACCCTTTCAGTCATACCGACTACCCAAAACCACTTGCCATGTCCAACGAGCATTACCACAATGCCTTATCCAGTTCTTCCAATAG
TTCATTAACCAGAGGCATGGGGTAGACCATAGATTGAGTCAGGTCAGTCACCAACCTATAGTCGATGCACAGCCTGATGACCACACCATTTCTTCAAAAT
AATAACAATTGGGCTGGCCCAGGGCGGGTTAGAAGGCTGTATAATCTTCGCAGACAACAGCCCCTTAATCAGGTCAGCCAACTTCTCCTTAAATTGAGGA
GCCACTTTTCGTACGCGTTGCGCGATCGGCTTTTCATTTCCCGCATCAATGTCACATATATACCCTCGGGCGGCTGGCGGTAAGGCATTCCCTTCCCTTT
CAACAGATGTCGCTTCTTCCATTTAATTTGTCGTAGCCGTTCCACCTCTACTGTAGTGTTCTTATCCAAATTAGGATTCAGGAGAGGGGTCCAATTCCGG
TATGATTGCCCATGCTCGGTTTATTTCTTCTCCCCAAAGGTATCCACTTTCGCACGTGCACACTTGTTCATCGTCCTGTGGCGATTCTTTAACATTGGCT
TTCTCTTCGTCGACTGCGATCTCTACCGATGAACCGTCTTTGGGACCAATTCGTTCTTGAGAGGTCTCTTCTTGTAGAGGCACCTTTCTTCG