Description :
From Genome Similarity Track
Location :
Scaffold_2:13233- 16407
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2-snap-gene-0.3960S ribosomal protein L35a-4
Pytir_DAOMBR486maker-pir_contig_2-snap-gene-0.58Ferric reductase like transmembrane component

Sequence
3174 bases(100 bases per row)
AAGAGCTCCTTGCTGACATTGTCTTGTGCTGTGTGTTTGCAGAACTTAATCAAAATGGTCGCTTCTTCTGGTCAACCAACTCGTCTCTACGTGAAGGGTG
TCTTCGTGGGCTACAAGCGTGGTCTTCGCAACCAGACCTCGCACACCGCGCTCATCAAGATCCAGGGTCTCCAGGACAAGAAGGATGTGGACTTCTACCT
CGGTAAGAAGATCGCGTACATCTACAAGGGCAAGAACCTGAAGAACAACACCAAGTTCCGCGTCATCTGGGGCAAGGTCATGCGCGCCCACGGCAACAAC
GGTCTGGTGCGTGCCAAGTTCGCCAAGAACCTCCCAGCTGAGGCCATCAGCTCGGGTGTCCGCGTCATGCTCTACCCATCCCGCGTTTAGATTCGTTACT
GCGCGGTTTAGTAATTGAGGAATACGAAAAGAGGTGTAATGACGAGTTCCTGTTTTCCAGCAGCGTCAAACGAGTTTCCATGTTGCTTTCGTTCCATTTC
CATCCCTTCTCTCATCATGCTGTCGCTGCTCTTAACCAACTGAGCTTCTCACTACTCATTCCCAGCCATCGTTCTCTTGATGATCCAATTCTTCGTCCAC
ATGCATTTTGCTTATGGGCTTTGACCATGTGCTGACATTACGGTCTCTCCATGTGTGCGTACATTCAAGGCTTGAAGTGATGAACAAAACTAAATAGACT
CATGCACCTCGTGCGCACTCTTTGGGTAGAAATTTTACAGATTCATAGATTCATAGTAAACGCAATTATTATAACCTCGGACAAGAACATCATCTACAAG
CAGACAAACTGTCACGCAACGTCGGTAGCACGCACGGCTCGCTTTTTCGCTCGCTCTCTAGCGCGAACTGCAGAGCTTTTCTTCTTTTCATCAAAAGTCT
ACAACTCAAACTCTTCGTAGTGGACATCGAAGATCCCGGCGAAGGTCTTCGCCTCACTCTCGACCGCGTGGATCATACCCATCGGGCCAGACACCCACGT
GCCGATGCCCGTCGTGCCGATCGCAAAGTTGTGCGACTGCTCCTTCACGACGTCGGCCATGAGCTCCTTGATGTTGAGGCGACTTCTGCTCACAGGGTGC
TGGAACTGCACCTCCTGACCGTCGAACGACAGCGTGTGCGAGTAGTTGGAGCCGCGGTCCTCGTCGTTCTGGATCGGACTGTTGCCCATCGGGTTCATGC
GAGACTTCTCAATGCGGCTCATGGAGCGCGGCTTCGACTCTGAGATCGCGACAAACCAGCCGGCAGCAGCGCCAACGAGCATGATGAACAGCTCCATGAA
ACGCTGCATTGGCCACATGAACTGGTTCTCGCGGCCCTCGCCGAGGATCGGGTAGCCCATGCGGATAAAGTAGAGCGAGAAGAACGCGGCAGTGAACGTG
ACGAAGAACATCGTCATCTGGCGCGGGATCGAGCGGGCAGATTGGTAGAACGGGCGGGTCGGCACCATGCTCGTGTCGTCCATCGGCTTGAGTGTGATTC
CGTTTGGGATATCCACTCCGCCAAGATGCTGGTCACCAGTGAAGCACAGGCGGACCTTGATCTTGGTGTGGTCAGGGTCGAACTGGTCGATGGCGTCCAG
CAATGGCTCGAACTCGTGGAAGATACCAATCTCACGAGACGTCCAGTGGAAGTAGACTTGAGTGTTCACCATGTTGGGGTCGTTGTTACGCATCGAGTCC
AGCACTTTGCCGAGGATACTGATGACTGGCGTTGCACCGATACCACCCGCGATGAAGACCAGCACTGGGTAATGCTGGAACGCGTCCGACATCTGTCCGT
AGAACCCGTCGACATAGATCAGCGGCATCTTGCGCTCCTCGCGAGCCTGGATCGCTACAGCGAAGAGCGACTTGGTCCAGTTGCCGATGGCCTTCACGTG
GACCGTGAACGTGTCTTCGTACTCGATTGGGGACGAGCTGATACTGAACGGATGCCACTGGGTGTGCGACAGCAGCGGGATGCGCAGGTACACGAACTGA
CCGGCGTGGTAGTGGCCTGCCTTGCCGGGGCTTCGACGGAACACGAGACGCGTGATCTCACCAGGGATGGCTTCGAGGTCGACCACCTCGCACGGAACGC
GGCTCTGGCTGTTTGACAGGATGCGATGCATCACGTAGAGACACACGCCCGGGTACATCCAAATGACGAACGACGAGAAGTGCAGCGACACCGCGACGAG
CACAACGATGAACAAGTGGTGGCAGTAGTAGAACAAGTCGTAGAAGCGGCGGCGCACTGGACCCATGGACGTGAGCCCGATGATCAGGCAGCAGAGCATC
GCCACTTGGCCCGTGAAGTTCTGGAACCGATTGCGTCCTTCCTGGCCGTAGTCACAGTCAAAGCACGGGAACGATGTCTTGATGAAGATGCCCGCCTTGA
GCCACGCGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGTGCCCCAGGACCAACAAGATCGTGAGCAAGCCGATCCAGCGGTGGTATTTGAT
GCCGTGCGAGTAGTCGATGCCCATGGAGATCATCCAGAAGCAGTTGCGCGTCGCCGGCAGGATCAGCAGCGAAAAGCAAAGCACCGCGTTGAAGCCAAAC
ACAAAGCCGACCGTCTTGAAGGTCGTCGTCGCATCGTTCGCACCCGATTCTTCCAGTTCGGTGTACTTGCGCGAGAAGATCGCCGAGAACCAGATCGCGT
TGAGTCCGAGAAAGAGCAGCGTGAACATACCCTCCGCGTACGACACGTTCATGCCGGCGAACATGATCTTGCGCTTGAGGAAGCGCATAAGCGTGCGGTG
CCAGCCGATCGGCACTGGAGGCAGCGCGTCGCCGAGCGCGAGCGCGATGCCGCCGAACATCGTCGGCAGACCGATCATCACGTAAAGCACCACAAAGTCG
ACGACTTCACGGTGACCGCCGACCCAGGCGTCGTCTTCAACCTTGGCGCCAAAGAGCTCGTACATGCTGTATCGTAGGTGCATGCGGTACTCTGGCAGCT
GGTGGAAGATGATGGAGAAGAGCACCATCGCGGCGCAGCAGCCGACGATCACGAAGGGCCAGCGCTTGTAGTTCTTGCCCACGGGCGTGCCGTACACGAA
CGGCGCGGCGATCGCCGACATCTGCTCACCATTATTACCGGCTCCGCCGCCGAGGGTGAAGAACTTGCCGTTGT