Description :
From Genome Similarity Track
Location :
Scaffold_778:13226- 14827
Transcript NameFunction/comments
Phypl_g10915hypothetical protein PHYSODRAFT_534407

Sequence
1601 bases(100 bases per row)
AATGGAGCGAGCTGATAGGACTGCTGGGCTCGATCACTGGATAGCCATGGGGAGAAATACATGAATTCACACCAGTCGACCCATTGTTTCCATCTACTTG
CATATTTtgaggccgacgacgaggccaaaGATTTGgactgcagcttgacgagAACGTCTTGTAAATTTTTATCCATGCTGACAGGACCGGGACCTGCGAC
CAAGGCACAGAAAATTAGACCAACGAGTTGCGTGGGGATCACCCCAACTTCTGGATGCGGCGTCTGCCATTATGTTTGTCTCTCCAGGTAAATGTGCTGC
CGACATTCTGATGTTGAATACAGCCTCCCCAAGTCCGATTGCTCGATTTAtttcttgagctgctgagcaCTTGCTGGAGGGTCGATTGCTCCAGGATACG
GCGGACTTGTtgtcgctccagcagcgaatGTGGGCCACGGATGGGGAAGGTGCTGCCGCCCACTGCTCACCCCAAGTCCATCTTGCGAAGGCAATGCAGA
GATGTTCCCTTACATTGATGGAGAGTGATCCTGATTCAATGTCCGCGATTTCGACGTCGTCGAAACGTACTTGTATAAATTCGTTCCGAACAGGGTTTAG
CACCGCGAGCCCAGATCCGACGCGTCCATGTAGATATTGTAGTGCGGCTCAGGGAGTGATCCAAACATGCAGAGCGGTAATTCAGAAAGGTGACCATGGC
GCAGAATGTTCTCAAACCAGCGTGATTCTGATGTCATAGCGCTTTGAAGAGATATTCTACCGAAGCGAGGCCAACGTGTTGTGGCCGAGTGGAGTTGCTG
GTAGAACGGTCGTGCTGTCCGAAGACAGGTAGTGATGTATCGTAGACTGCCGAGTACTTTTTGAAGCTCATTGCGGATCGCTTTTCCGGTATTTAGCAGG
TTCTCGATACGATGAATGCCCTTGTCATTTTTACCCTGTGGAATGGACAACGTGCGTTCCTTGGTGTCCCACGTGAGTCCAAGAACAGTGAGGCGAGTCT
CCCAAGATGAAAACTTGGCTTTATTGATGGACCGTGAGCCGAGAATCGCCTGCATTGAGTGGCGAAGGGTGGCTTCAGCCAGTTGAAGCCTATCACCCGC
GTCGATTTCGATCACGATGTGATCGCCCACCCACTCACATCCGAAGAAGGGTGTTCGATCGCTGGAGTCTGCTACCGTGGCAGGTGAATTGTTAGATACT
AACCACGAGATTGCTCGACCAAAAGCACCGTAGAATTGAGGAGATCCAGACCAACCGAATGGGGCCGTCATATCTATGACTAGAGCATTCAGTTCCCGAA
TGAGGCCTGCCATGCAATGGACGTGATTGGCATGGGTCATCAGGTGTCGAAATGCGCCCTTTACGTCGCCTTTAAGCATTCTGATGGTGCATTTCGGGTA
TTGCTTTGCCAGAAATTGGATGGAGCGGCAAGCACAGTCACGAAAATATATACGAGTTCCGGTAAGCAGGACTTGTCCAGGAGGTCGTTCGTGGAGGCTC
CAGCTGGAAATGAGAGATCGTGAATTAGTCTGACATCGATGAGAGGGTCGACGTCGCTTTTTTCAACGGCTCCGAAGGGGCTGCAGTGTACATTTCTCCA
C