Description :
From Genome Similarity Track
Location :
Scaffold_307:13221- 14750
Transcript NameFunction/comments
Phyra_85773Amino Acid/Auxin Permease (AAAP) Family

Sequence
1529 bases(100 bases per row)
GAGAGAAGCTCAGAACTCTAGGACTCGTGCTCAGCCGTGTAGTTGTAGTAGATCTGGTTCTCATACTCCGAGTCGCAGTAGGGGAACGATGTGTCATCAT
TCGTCGGGGTGAACAAGCTCTTGCCGGTTGTGTACGTCACGTAGCATCCAAGTACGAAACATATAACGACCACGATTATAGCGGCAGCCTTCTCGTACAA
AGGGGTGCTTGTCCACGCCTTCAGGAGGTAGAAAACAATCGGCAGCAAGATGCAGTTCACCGTGATGCAGGACGCGCCCACAAAGTCGGAGAAGTCCGAG
AAGTGATCTTGGAAAATGATGGAAAGCACGACCAAGATGACAACGATGACGACGCGCAGCACGATGTACTTGATGGTGTTCTTTCCACCACGGTACTCCG
CCGCCTCAGCGTCTGGGTCGTCCTTGTGGACGCGCTCGCTATCGGCCACCGAAACATAAGACATCTTGGAGCTGCGGCGCGGCTCCGACTGGATAACTGC
AGGTGTTGCCGACTCGGCGTAGCTGAGACCAGCCTCCATGTCCGACGTTTCCTTCTTGTGCATGCCCAACGCCATACGTTCTGCGAGGAAGAAGGCCGGG
TTGATCAAAACGGAGAACGCGATCGTGATGTGCAGCTGCATGAACAAGTAGGCCAGCACTACTGCGCCCCAGCTCGGCTTGAAGCCCAGAGTGGTCATAC
CGGTGTCCTCGTCCGGGTAGATGGTGAAGAGCAGATTCCCCGAGATCTGACAGCCCACAGCCGAGTACGCGGTGCTGGCCAAGACCAGGAAGAGACACGA
AATGAAGCTCACAGTAACCATAACGACGCGAGGCATACGAGTCGGGTCACTGTGCTGCCGCTGCAAGTCTGGAATGACAATTCCAGCGCCGTATGCCAGT
GCCAAGTTGCCGAAGCAGCCCAGCACTTGGGAGATCTTGCGGTCGGGTGACGGCACACTCGGGTGCCCACGCATGCCGTACATTACCACAGCCACGCCGA
TCACGTCAGCGAGAATGGTTCCCAAGCAGCCAGCGAAGGCGGCGCCAGCTCCTTCCTTGAGTGTCGGAATGAGGCATACAGGCATGACCATGAGTGCCAT
GAGGATGATCCACACGGTCGCACTGAAGGCGTCCGGAAAGAGACCGTCGAGCAGCGAGCCGCCCAGCACGAGAAAGACACACGGGATCAGCAGACATGAG
CCCATTTGCGAGACGACACAGAGCCAACGGCCCCACTGACCCATGCTCCACTCGCCGAGGTCGCTGAACGTCTTGACGGACTTGGGGGCGAGCAGCATCA
CTCGCGACATCTTGACGGACGCGTAGATGTTGGCGAAGGCCATGAAGGCCATGGCGATGACGGCGATCACTGGACCGGCGCGCGAGAAGTTGCCGGGCAT
GCCCAGCGTGCCAATGCCGTACATGCAGCAGAAGAGGTTGAAGGACGTCTTGGCGTCCTCTAAGGTGAAGAACGGCATCGTCGGCGGCGGAGTAGGCGAC
TTGAGCCGGACGTGGCCAAAAGCGGAATG