Description :
From Genome Similarity Track
Location :
Scaffold_36:132191- 134203
Transcript NameFunction/comments
Hyaar_Emoy2805205unnamed protein product

Sequence
2012 bases(100 bases per row)
TGCTACTAGTGGCGATGTAATTGTTGATACGTTCGAAGGCGTTATCAGAAATGGTATGCGAATGCAGATATACTGTTATTCACTAACTAGTTGAAGTTCC
ACGATGCGGCACATGACAAAATCGACACGGCAACAGCTACGACTTCACAAAATGTCAAAAATTAAGTTGAACTGGACAGATTCCTTGGCACAGTAGCAAG
ACGAGACATCATAGGCCGCTGCATTATCAATGTACTTCTTTGCTGTTTGATGCGTCCATTGATCTGTTTATCTGCAATGCTTGATCTAAAAATGGAGTCT
AAATGCTGTGGAATGATCTACTACCATGAAATTATCTCGTTCTCGTCTGACCCAGTCCACAAACCGCATTTTATCCGCGCATCACTCCGCATCATGATTG
GCTCATAATGATGCCGACTCCTCTCCCCTTTCAGTCCACATTTTACTTGCTCGACACTCCCCCATATCCCGAATAATGGCTGCTAAGTACCAGATCGTCC
TCATCCGCCATGGCGAAAGCCAATGGAACGTGGACAACAAGTTCACGGGCTGGCACGACGTGCCTCTGTCCGTCAAGGGCGAGCACGAATCGCACGATGC
AGGCAAAGTGCTCAAAGAGTCGGGCTTTAAGTTCGATTTAGCCTACACTTCCGTACTTAAGCGTGCCATCAAGACGCTGTGGAACATTTTGGAGGAGACA
GACCTCATGTGGATTCCCGTCGTGCGATCGTGGCGACTCAACGAGCGCCACTATGGCGCACTTACGGGCTTGAACAAACAAGAGACAGTGGACCAGCACG
GCCTCGAGAAGGTCATGATCTGGCGTCGCAGCTACGCCACGCCCCCGCCGCCGCTCGAGGCCGACAGTGAGTACTACCCGGGCAACGACCCTAAGTACGC
AGACGTACTTAAGGAGCTCTTGCCCTTTGCCGAGTCGCTCGCCACGACAGGCGACCGCGTCCTCCCGTACTGGGAACAGACCATCATTCCTTCCATCAAA
GACGGCAAGAAGATTGTCATTGCGGCTCACGGCAACTCGCTGCGAGCGCTCGTGAAACACCTGGATCAGATCCCGGAGGACGCGATCACGGGCCTCAACA
TCCCCACGGGCGTCCCGCTCGTCTACGAGTTGGATGAGAACTTTAGACCTGTGCCGCACAAAGACGCTATTGCTCCCTTGTCTGGACGCTACATTGGCAA
CCAGGACGAGATCAAGGCGCGTATTGCGGGCGTTGCTAATCAGACCAAGGCGTGAGCAAGACGTGCTTGTGCTGCAACTGCTAAATCCTCCGTTTGCCTT
TTAATATCCTTTTCTCTGTCTATGTTCAGCCTTGATGCAACACATGAAGAGCTATTTCCAGGACTAGTACCTCCGCAAATCTTTTTCCTTTCGAAATGTA
GTACTTGTACCTCCTAATATAGGTGTATGTATGTCTGAGCCAAAATACACCACACTCACGAATCTGTTAACAGGACAATGTGCGATAGGTACATTTTCTG
GACTATATATATGTACAGCAGTTCAAGGGCTCTCGCGAATATGAAAGAACTGTGCTGGGGCTATTGGCACCCACGAGCTCAAATCTTGGTATCCCAAGTG
TTACAAATGCAAGACTACAGATGACTAAAAGAAACAGATTCAAGTCATTTTTTAAAGGTTTTATGCCATTAAGTCGGACTATTTAGGTGAGCAACCTTAA
AGTTACCGAGAAGAGCGGGAACCGAGCAGAATCGTGGGTTTGTTATATCACTAAAATCGGTATTTGTCAGTACGCGTATCGCCAGTGAGCTTGTTGACTT
AGATGGAGAAGAAGCCGGTGATAGGCTAATCTGAGGTCAAGATGCTACCTGATGCTTTGGATGACAGGTTAAGTGCGCAATGGATGCTTTCGGGCACTAG
ATGGTTGGCTCCTGCATATATAAAATATGTTTATGAGTGGACAGTGTTTCTTCTTAATCAGAGAATGTGCAGAATTTGTGTGAGGATATGTAAGTTAATG
AACACTCTTGAA