Description :
From Genome Similarity Track
Location :
Scaffold_947:13219- 16086
Transcript NameFunction/comments
Phypl_g11780hypothetical protein PHYSODRAFT_560168

Sequence
2867 bases(100 bases per row)
CCGTTATACTGAAGTACTAAGTATGCGCTACTGCGTGGACTTGCACTGTTACGAATGGTGCTTGCTCTAGGTAAGTCTTTCGCGGTAGTCAACTCCTGCG
TACGAGCTTAAATTGTAAGCATCTCGATGTGGATAAATTTTCGCCATCCTCTTTTAATGTGTTTTACTCGAAAGGGAGGACACTATGTGTGATTCGTGAA
AGTTTTCATTCTCAgggacccccccccccctgaTTGCAGCCACGCTCAAAAGCGGAGCAGCCTCATTCTTCACGATAGACGGTCCATGTGCTGGTGCCCT
AGCCAACCCGTCTGTTCCTTGTCAGGCCCAATGGAAGTTCCGACGTTGTTGAAGTGAAGATGTTGCGAGAAATGAAGACCCAGAGGAGAACCACTCAGCC
ATCCCCAAGGAGAGACTCGAAAATCAAGCAGAGCTAGATCCGTGACGAAACTTCCACAGCAACGGTCGGTACGCGTGGCAAACGTAAGGAGGACTATGCA
AACCAACGACCGGGTCTTTCTCGCTTCCTAGCAGTTGCAAACCAATTGTAGCTGCTGATACACGACAAGTTGAATCCATTAAAACCCTTATTATGCAATG
CAGTATTTTGCTGCAAGCTTATCCAGTGCACTGCCAACCATTCTATTTTCGCTTGTGAATTTACAGCAAGCACTCGAACCACTTCAGaggcttcttcgcg
ctgctgaaAAGGCCTTCGCCATTGTGGAACGTCGTGTCGGCGTGGTTCAGAGCAACAGCGTACCAAGTGGTTGAGTACGAGGTCTCGAACGACGAGGAGT
CCAGGTTTCCAATGCAGCTCTGGAACTCGACCTAAATTTTTGCCACAACAAAACACGTATAAATTGTTAGCAACAATGCAAGAAGCCAATGTCGAAGCTC
CGCAAACTTACAATTCCGTCATTCTTTGACGAGTGGTGAGGGATGAGCAAGCCTCCAGCCAGTAGTCCAGCGTATTCACTGGACAGCAGACCCGAGTACG
TCGTGCCGCACATGCCAGCAGTCACGTACTTCTCATGAACGGTTCGTGCCGCTGCGTAGCGAGCGGAACATTCGGAGTCACAGTAATCACCGCCGTCGTA
CACAAGTGACCGACGCGTAGTTGTACCAGGGCACTGGCCAATAAGCCCTCCGAGCTCAGCCAAAATATCCTGAAGCACGTTGCCACCGTCGCAGATTTCA
TGCAGGAAGTCCGACCCCATGCTGCCCTTCATGGGGCCACTCAGAGCCACCCAGtcgacgttgctgccgaTAGAGCACTTTCCAGTTGCCAGAGCGCCGG
CGAGCATGTTGTTGCCCATCGAGTGAGCCACAATAATGAGGTCATTGATCTCTGTAGACCCGCTGTCCGTGGTGCCCGTGCTCACGTTCATGGCAGCATT
GCAAGCTTTCTGCTGAAGTGTTTCGTTGTACCATTCGTAGTCCACCGTGTTCAAGATGGCAAAACtgaaggacgagcagcacggtgCGTGCTCCTTGACG
TCGCCGAAGAACGAGTAGCTGTCGACGATACCGCCGTCAGCCTCCACGTCCATGCCGTGGAAGAAGAGACACGGACGAGGCGTGCCCTGGCAGGTGCAGG
TAGAGCTAGCAAggtgcgcagctccagcctctTCCTTCAGAGCGCGACGCGTGCTCGACAGCGTTAGACCGTACAGCTGACCGAGAGAAGACAGCGGCAC
GGATCCATCCGACACGACGCTGCAATCGCTGGGAGCATTCGTCAGCTTGGTGATCGtcacgtcctcctccagaTACTCGAACGAAATGCTCAGATCTTCG
CCGTAGATTGTGAAATTgccatcttcagcatcaaCGCCCGTGCACAGCACGTAGGACTCACCCGCAAAAGTTGTGCTCAGCCAGGTACCGTTGTTGCAAT
AGATTTCCTGGTCGGTGTTGACAGTGGAGACGGCCGTAGCCGACGCGATAGCGTCCACGATATCGGGTACGCTAGGGTAAAGCGCCGTGGGCAGACACGT
GGTGGAATCCGCAGTGCTGTTGACGACTTCGTGGTACGGAATGCTGtccacgacgaagaagttgtgGGTCGTGCCGTTCTGCTCGAACGTGACCTTGCCG
TCGAATGAGACGTTGGCGCCGCTCAGAACAGGCTTGATGTAGACAtcgaagctggaggtgcCGTAGACTTCCATGGTGGATCGCTGGATGTTGAAGCCGA
GCTTgatcgacgacagcgaggaggtTGCAGCAACGGCGTCAAAGCCGGCGAGGGCCGCCGCAATCGCAGCGAGGACGCGTGCTGCCTTCATATTCCAATG
AGGGAATGGAAATCGAGTCTTGAGCCCCACCGAGCAAGTTGCGTAATGAATTGAGGGCTCGTGGCCGGGCGCCATCCTGGCGAGCTGGTCGATTCAACCG
ATAACGCCTTTCATCACGCGGGCAGGCTCAAAGCAGACGCCGGTCACAGGACCCCCTTCAACGCGATCACTTGAACTAAGCAAGGATTTGAAGATATGCG
TTTCTGAAATCCCAATTGACTTCAATTAGTATGTGAGTTATTATATGACAGTGACAGATATAACGTAAAACACAGGTTCCACTGACAGGTGGACACATTT
TGCTGTAACGTTTCCGACGCCAGGAAGTGTAAAGAAGGACAGGGTTTGGATACATCCGTCGACGTCTGCCGCCAGGGCTGCACGCTGTGCGATGTTACTC
ACGAGCGGGTGGATCCCGTTCGGATGGCCACGATGCCAATCAATCGTCCGCACcgggcggaggcggcggaaCGTCTTCGTGGCGACTTGGTTGAGCCAAG
TGCTCCGAGCAGTGTCGCTGCCTGTCTGCGTGCGGGGCTCGAGTTCATTTCTCCTCGCGCATCCTGC