Description :
From Genome Similarity Track
Location :
Scaffold_175:13218- 17848
Transcript NameFunction/comments
Hyaar_Emoy2811902phosphoglycerate mutase family

Sequence
4630 bases(100 bases per row)
TGGTTGCCTTGAAGCTGTGAAAAGCCAAAGTGATTTCTGAAAGTTAGGAGGGATCCTCCCTCGAACGAGCAGCTAGGATAAGGAAAAGGCATCGATGAGA
CACCACCATCCATCACAATTTGACTGGTCAGTACTACAACATCCGTCCGGAGACCGAAGACGAGAATACGATGGATCAGTAAACCTCCTTTTTCTACATA
ATGAACAGGTCCTGGACCAGCCCGATTGCCAGCTAGACTGAGTTTTCGACCTTTAGACCAGCAACTACGATACCGTGAACGCCACGTTGATCTTCTACTG
CAACTCGTCCTCTCTCGCGTCAGTAATCAACATAGGGATGAACTCTGCATTTCGAGGTCGATAGTAGCGATGACCCACTGCCGCAAAACAGCCGCGACAA
AAGCCGCTGTGCGAGACGACGAGCACGCAGCGCTCGTCAACCTTGTCAAGCACCTTGTCCAGGAACGTGGCCGCTCTTGCAGCAATCTCGCTGCTCGTCT
CTCGATGGTCTGGTTGCCACCACGTGTCATCGTCACTTGCTACATGGACAAAGTCCAATTGCGGATACGCCTCTCGCTTGGAGGTGATGACTTTGCGTCG
ATCGCAGTTGACGACTCCAAGGGTCTCTCTCGCTAGCTCCATCACGGACACGGGAATGTCCCGCCGTCGGTGACACACCCGGTCGTACGTCTGCAACGTA
CGGTCCAACGGAGAGACAAACACCCGTTGGAGTTGCAGCCCGCAGTCTTCGATCTGCCCCTCGAGCATCGAAGCAGCAGCTTCAGCCTGGCCCTGGCCGC
GTGCTGTCAATGGGGCGTCAATGAACTCAAGTAATCTCTCGTACTGTTGCTGCCATAGTTTCGCACCCACTCGGGCCTTGGTGGCGTTGTGTGTGGCTTC
TCCATGTCGTAGTAGAATCACCAACTTAATCCGTCGAGAGGGATTTCGGACCCGAAACTTGTCCATATACGCGTAGACATCTGCCCAGGATTTGCCATCT
AAGAGTCCCATGCGCAACGGTGGTTCCCCCATCTCGTCCACTGCTTCGTCTGACATGTCCATACGAAAGAAACCGGAGACGCAGCGCAGATGGGCGGATA
CTGGACGTGAAGATGTCGACATGGGGCAACGTGCTGCTTGTGGTCAATTGAGATGTAGGGAGGACTATTGTGTGGATGTGCGGGTGACTTTTTCCTAGTA
CTTGACGTTATTTTGGCTTGCGCTTGCAACGAGTATACTATAGACTTTGTCATGGGACGGGCGATTCAGATGTGACTGGACGGACGTGTCATACGTACAT
GGCACACTATAGAGAAAATATTGCGTCTCACAGTGATCGTTTCTCATACGTTTTCAGCTGAACGTTTTGCAGCTGACACGACGGTATCAACTACTTGGCT
CAAGTTATGTTTTACCTTCACGAGCGTCTGGATCGCATCAGGCTCATTGTAGCGACGCGAGAGACCAGTGCTGAGACGCTGACAACGAATGGAGTAGTCC
AAGCTAGTTCAAGTCCTTCTTGACTGTCTTTTTCTTGCTCGACAGCGCCATCTTCGCCAAAGTGATGAAGATTTCGTATAGCCAGCTTTACTGGTCCGTG
CGACTTGAACTTTGATAGGAGTAGAGGGTGAATGCAGCCAGCGCTGTGTAATTTTAAGGTTGCTGTCCAAGTTCTAGTCGAAGGTGGTGGCTAGCAACAA
AGTGTCTCACGTGTCGATTCAAACTTGTTCGCGTGGAGACATCATCCCGCCGCTATAGTCTGCATCATCGTGTCACCTAGGCACAGACCGAGCGACGATT
CAATCGAGCGACCAGATGGAGGTATTTCTGACACGCGTCTGACATGCAACCATGCTACCTTTAGTCGTGCGAAACCTGTCAGCATGCTTTGTCGAGCGCA
TCACAGTGCAAACTTTATGTCAGCCCGTGTACCATAAAGACGCCTATCCGTTCTGGCGTTGCCCACGGACGCTACCGCAAGACTTGCCCAGTACTTATAC
GGCGAAGCAGCTGACCCTGACATTCGTGTCCGTTATGGCAGTAAAAGCTTCGCAACTGTAACGATACGCGCGTCCAGCTCGCTTGAGAGAGGAGACTGGA
TGGTCGAGACCATGTATTAATGATATTAATTGACGTACACGTGATGTACGTGCTCGAGAAACAGTTCCCTGTGAGACGGCGATACCAGAATAGATATTTC
CAATGCCGCCCACTGGCGAGCCGTAGAAGCTACCGCTCTTTGCTAACATTCTATGACTATCACAACGGGTGATAATTATAGCTCCACATGATCGTTCGGA
TCAAGCTTAGTGCTCCACAGAGCCGCTGACTACGACAACATTGTTTACTTTTAACTACGCATGTGTCTCTCGTGGATAGTGCGCCCACCTCATGTGCAAG
ATCGAGTTTAAGCTTGGCGTAGTGACAGCTCTGAAAACGTCCCTCAGCGTATCCACCATATGCGCTGAAAGCAGTTAGCTAGACTTCGTAAGAAAAGCAG
ATCTGGGAGAACGGATTTTGCGATACGTTCGGGTTGGTTCTCGTCAACCAATCTGCCTTACTTCCTTTGGCTTTTTATGGCAACACCTGGTTGCTGGACA
ACGAGACGACCACAAATGATCAAACTCGTGTCGTCGTGCTAAACACCAACGGTCATTAATAGGGCTCCGTCCCGCGCAGGACGGGATGGGACGCAGGATA
CTGCGGACGAGATCAATGAGTATCTTACCCTGCATATATTTCGAAACGACCTTATCTGCAGACATATGAGCGCCTCTATATGCGCTGAGGGTACAAAAGG
ACAAGAATAATACTGGAGCAGCAAAATAATCCGCTACGTGATCAATGCTTACCTACTACAAAAGTGTAGAAGCTGAATGCCTGTTCCACTAGATCCGATT
TGGTGCCGCTGATGGCGTACTTGTGCAAGCAATGCTCATCTTAAATGTGGCCGTAACGGAATTAGGAAGAATGACCACACGCATTAACATCAATGCAGTT
GAGTTCCAGCGAGTACAGACGTGATGATGGTCTTGACGAAAACTTTAAGCTGTGCGATTGCTCGAAAGCGATCTTGACGCTTGGTGGAATAGTAAAACCA
TTTGACGAGGCTTTAGAGAAATCATGTCACTGCCAAAAGAAACTTATCTTCCCAGAGATTGAAGTCGTGATCTTCAAGTATGTCCATCGGATCGTCGCTG
GGGGCAACCAAATCATCTTTACAAGCACCTATAATGCCTCGATGTATGCCTTGGCAGAATGGTCGAACAATGTCACTAAATTCTGAATTTGACAATTAAT
ACATATAAAACAGATGACGCTTTCATTTTACCCTCTCTTGATTCCCAAAGAATCATATGAGTAGAAAATTAATAGAATCTTAATGCTACATAGTAAGAAA
ATTATAGAGTGCGGGATGTGCGCAGGATTGGTCATGGCTCATCCCACATCCCATCCCGCGCGGGATGGGATGTGGGACGCGCAAGATGGGACGTTGCGGG
ACGGAGCCCTATTCACCAACATAGCCACTTTATAAAAATCAGGCTATTGAATTTGAATCGAAAATACCAGAACGAGGCGAAATGATCAAATTAAGGCTAG
TGATAAACGGCTGATTTCATTTTTATTCGGCTGGGTCTTTTTTAGGTATAGAGTAAAAAGTCGTTATTTACATGTTGTAGAATATCGTTTAATTACTATT
TTTTTTAAATTGACTGTTGGTGACCCTCTCGCCAAAGGGGAATTCTCGTGATAGCTCTCGCGTTTCAAGTACGATGTAAAATTTGTTAGAAACTGCATTT
ATGCAGTTTTGTATAGTCGCATCACACTAGTGTCGAGCATGCTTGAAGAGGCAGGCAAGGTCAGTTGAAATAGCGTCTAACGACTTAGACCCTATGGATT
TTTTAGCTTCGGTTGCTGAAATCAGCTTTAATGGACACAAGCGATAGCGAGGAAAGACAGATAACGTAGGCGCAACACCAACGGCAGAATCCACAACGCT
ATTGAACTTTTCTTATTTGGCTAGCAATATTGGCTATCGAACCCAATTACCTCCTATTAGATAAGTGTTGATGTTCTAGTCTGTGCGCCCACTTCCGACA
CTCGCAGGGGCTCTTTGCGAGATCGAAAACACATACGTTTGTGTATTTACGACTCAAGTACGATTACCAATTGCCGCGTTCAATTTTACTATGCGAATTT
GCTGCTTGTTGAGACAACTGCGGCAATTCGAACAGTGTAAATTTCTCGATAATAGCAATTGTAATTGAATAATGACGTAAGAGCGTGCCAGAAACAAACG
TTCAGGCAATATATATCGCCCCACCATAAGTGCTCGCGGTCGCGCGGATGCATCATGCTTGGTGGATCTGTTGACTGTGTAGCTTTGATGGCGTCAAAAA
GCGACGTCGTCCTCAGTATGGAATGTTAACAGCGGAAGGAAGGACTGGGTAGGGTATTAGCCTGTTCGCACCGATATCGTCGTTATGAGCTTAAATGGGC
AAGTAAATAAATAGTGATACCAGGTTGAGTAAACGGGATCTACTGTTGACGAAGCTAGGCATACTTCTGAGTTACTTTCGAGTTACAGTGCTCCCTCTGA
TAACTTTTCCTCCGATAACTGATAACCTCC