Description :
From Genome Similarity Track
Location :
Scaffold_61:132136- 135223
Transcript NameFunction/comments
g13920.t1hypothetical protein

Sequence
3087 bases(100 bases per row)
CCAGCCAAAGAAAGTCAGCCAGTTGAACGAACGATTCTTCAGGCCGTTCACGTACAGCGTCGGGTACTGCATCAGCACTGCAGGAGACACGTCCTGGTTG
TACATGGCAATAATCACGATCGGAATCGTCGTAAACAGAGCGTTGTAAAGCGTAAAGAAGATGCTGAAGTACATCAGCAAACCACTGTACATCGTCTCCA
TCGCCAAGAAGAAGTTAGACATCGACAGCGCCACGTTCTTCATGAACGAGAACAAGATCAACTTGGAAATTCTCTTGTAGCTGTAGTTGCCGTGCACCAA
AAGAAGGCGCTTCAGGAAGTGAAACTCCGCGATAGAATAGTCACTGGAAAGAACGGCTTGGCGGCCCTCTTTACCACTGATACCGACACCCACATTCGCG
GCTTGAATCATCGGCACATCATTTGCGCCGTCGCCGATAGCAAGCGTAATGTTGCCAGGTGAGAACATAAGCGTGGGTTCCGTAACCAACTTCACCACTG
ACGCCTTCTGGGCGGGCGAGCAGCGGCAGCAAATCACAGATTTACATTGCGTGGCCACTGCCAAGAAGAGGTATTTGATGTCATCATCCAGCACCAGCGC
CAACGTTTTGCCATCAATAACCATAGCAAACTCCAGTTCCTCGTCGACGTAGTCACCGCTGCTCATGCTGCCAGTACCACCCGTCATCGTATCAGTTTTA
GGCTCGAAATCGTGGTCGCACAAACCACGTTCGAAGCTGTTTTCGGAAATGTCACGGTTCGGCAGCGCAGGATACACTTCATCGAAATGGACAGGGCTGT
CCGTCGGTGTCGTATCATGTTCGCGTCGTGGCAAGCGTCTCCTCTTCTTTCGGGCCTCTGCTTCTTCGTCGCGTCCCACAAGTGCCAGTTTTATAAGATC
CCACAGATACAGAATCGCTCGCTTCAACGCTTCCCACAACACACTGAACGCCGACGAGGTCTCATCTGATCCCCATTTGTCTTCAACAAGGTCGACGTAC
AGTTCTTCCAGCCGAGTACGAAGCGAGCCCTTGTCGCGCTGGCCCAGTACAATCACATCCATATTATCATCGATCACGTGTGACGACATGCCAATGCTGA
GCGCTGTTTCCTTCTTGTCACCCGTGAGCACCCAGAACTTAATACCAGCCTTGCGCAAAGCACAAATAGATTCTTCCACACCGTCCTGCAGTCGGTCTTC
GATGGCTGTCGCACCGAGCAGTGTCAACTCAACCTCAATGATAGCCGAAACCTTGGCAATTTTTGCGGCACGTCCCTCCATCGAAAATTCAGCCTGTCGG
TATAGGCTGCTCCACTGTTCATACTCCTCTTGGGTAAGGCGACGCATTGCAGTGGTAAGAGTTCGAAGGCCTTCCGACGCGTACTCCTGAAGATGACCAC
GCGTCACATGCGCCACACCCTGTGGCTGGGTCTTGGAAAGGAGATCGAAAATGACGTCGTCTGCACCCTTGCAGTAGAGCACAATACTACCATCGGGAAA
TCGTACAACCACTGACATTCGTTTCCGATCGCTGTTGAACTCTAGCACGTTCAAAATCTCAAACGACATCAGTCTTCCTTGAATGAGAGCATTGCAAATC
GGACCGTCGCGTGATTCAAGAACGTAGCCGAGGTCACTCGCAGCCTGTACAAGTGCCTCCTCGTCAGGGGAAGACGCATTGTATTTGATAGTTGCTGTCG
GCGCCGAACAGGAGTCGCCAGTGGATGTAGGCGATGCGGGAACATTGGTCTCGGGTATCACGGTGTTGCAAATGGTAAGCAGTAGTAGGAAATCGTGGAT
CTCCTTCTTTGTCGAGTGGTTCGAATTGAGACGCGCCATCAAGCGGTTATCATTGAACCGAGTTCCAGGTCGCGTGGGCTTTGCAGGGTCTACTTCGATG
TCATTGTAGCGCAGACCAGCCACAGTACACTTCGCAAAGATCATTTCGTTGCAAGTGAGTGTGCCTGTCTTGTCCGAGAATATATACTGAATCTGGCCAA
GATCTTCGTTGATGTTGCTGTTGCGAACCTGAGCTGGCGTATCTGTCTTGGTGTCGTACATCTCGAGATCGTTTTCAATGTAACGTGCGTGAACAAAACG
CACGCCTTCCATCGTCACGTACATGGAGAGCGGGATCAAATTGTTGAACAGGATCACGTAACTCAAAAAGATGTAACCGTTTGAGTCTTCCTCGATGTAC
CAGGGCGTTGTCTCGTCAGCCAGGTCAAGGTTCCAGTTGTTGTTGCCCAACGTGCAAGCAATTGAAATTCCAAACAGTAACATGAGCACCAGAACGAACA
TGGTGTCCAGGGTCTTCTCCACAAAGCTTCGCTTGAGAGGCACAGCCGTGGAGTTCATCTGGACCTTCGTCTCCTTGCCCGTGTAAATCACGAGTCCCAA
CGTCCATTCAGAGTTGCGGCTCTCACTGCCACGCAGAAGCAAGTTGTCCATGGTCAAACTTGATTCGTTGTCGTCGTTGTTGGCATCTGCAACCGCATCG
TCTGCTATCTTTCCAAGTCTCAGCACGCCGTCGAAATAGAACAGGTCCTTGTTGGGCACGTCGCACTCCACCTGGAGTTTGTACTTCTCCAGAATCTCCT
CTGCAGTCATAAAGTGCTTCGTGCAGCTGGCTACCTGGCGGATCTTCAGGTTAGTTTCGCCATCCAAGTTGGCCGTCTCAACGTAGCATCGGCCGTCGGG
TCGACTTGTCGCCAGCAAAATGCAGTCAGCCGGAACCTGATCGCCGTCCTTCAACATCAGTACATCTCCCACTTCGATATCCTGCCAAGTGCCATCGATG
TGCATCACCTCATTCACAACGTCGCGGCGAATAATGTGCGCCGGCCTGGAATTTACCATGGCGTCTCCCTTTTGGCGACGCAGGTCTTCGCTCACGTCCT
TGAGTGCAGACGTCGCGAACACGATCAGCAATGGCGTCAGACTAGCCACGGGACTCACTGGCGAAAAGTCGAAGAAACACAGCGCCACCACGATGGTCGT
ATAAAAGTTGGCGAGTCGGCTGAACTGCATCTTGAGGAACACGAACAGGAAGTTGTAGTACGTGTACTTGCTCGTAACGATGAGGTT