Description :
From Genome Similarity Track
Location :
Scaffold_308:13212- 15515
Transcript NameFunction/comments
Pytar_ATCC12531snap-par_contig_308-abinit-gene-0.16Vacuolar protein sorting-associated protein

Sequence
2303 bases(100 bases per row)
ATGACGCATGCATCCTCGTACGAGGCATACACTTCGATGGGGCTAAACTTGAACGCGACGATTTGCTGCTGCTGGCCAGCGTGCGGGAAGAGATCACTCA
CTTCCACGTGTACGTCGCATGGCTCGACGATCTGCACAAGCTGGCCAGCAGCGCCTGAAGAAGAAATTTGCGAACCTGCGGAGGACGCGCATCCTTGCCG
TCTTGCGTTGCGTGCAAAGAGCTCAATTCCCGTGCCATCAATCACCACGCTGCTCTGAATGTCGAGATCCGAGCCGCCGGCTTGCTGCTCGTCCGCGCAC
CGCTGTGGCTTCCACGTATACTGGATACTGAAATCGGCGCGCATCGCAATCTGTTCGCTCGAGGCATTCGACAAATCTTCGGGGAAGGCCACCGACATGT
CCTTGCCCCGCAGCACGATCTTCAGATCGTAAGCGTCTTGGCCGATCGACGAAGACTCAGTGAACATCGACTCTGTTAGGCTCAAGCGTCGGCCCATGGT
TGCCGAGGTTGGAGGCGGTGATGGTGATGCACCTGACGAAGGCACTGCCAAGTAGTCAAGGAGAAGCAGGATACTCTCGGGCACCACGACGCCATGCAAA
TGGTCGCTATTGACGTCGATCTTGCATTGCTTGGATTCGACATGCCACGCGTAGGAGACTTCAAACGGTCGCTGGCAGTGGAAAATCAGGCCTTCAAGAT
CTGCTGAAATCCGGTCTTGCCCATCGAGGTGCCGCAGACAATTGGTGGCGCGATCTTGCAACGAGAAACCATCGACGCGGACCACAATACTCGGCCAGCG
ATCGCGGAGTTGGTTGATGGACGCCGACAACTGCGTGCCCGTGAGTGTAGCGACCGGCAACCCTCGGTGCTGATTGCCAGGGGAGGAGCGTTCCACAACG
TGATCCACTAAATCCGTCACATCCAAGGCTGCGGTGGCGATGACGCTCTTCGCGTCTTGAAAGAGATCGCATCGCACGGCCGCCATCTCGAAAATCAGCT
GCATCGTAACGACTTCGAGATCTGTTCGCGAGTACGAGTAAACCATCGCAGGGCGGGAAGCCTGATCAATCTGCTGCCCGTTTGAGTTCGGGACGAGCAG
GTCAGCGCCAAAGTTGCCTTCAATTAGCGCGAGCATTGCACGGTACTGCCATCGCTCCAGTTCAAAGGCAACTTCTTCCATGGAGACGCGCACAGTGAGG
CGAGGCAGTGCACGACACTGTAGCGAAAAAGAGCCGGCCGACACGAGGTCGTCGACATCAATAGAAAGGTGTGTTGGCGTGCGTAGCACACTGCTATAAG
TGATGCCCCCTCCGCTGCCACTGGTCGCACAGTAAATGGTGGCGTTCGTCAACCGTACACGCTTGCAGTCGGCGCGGATCGAAATCTCCTCGGCTGAAGT
CTCTTCGATGATGCTCCCAATATGCTCGCCACTCGCAAACAACGAGACATCACGTTGTCGCTGCGCGAGCATGGGTGACAACCCTCGATAGCGAATTACA
CTTGACGGGAAATGCTCCAGCGATAGACTGTCGGACGTGAGACACCAATGCGCAGCGTCTTGTAAGCGAATCGGAAGAATCAGTGTGGATTTCTTGACCG
TGACTTCAAATCTTGTGCTTGAGGCCTCTTCGTTCAATAATAACCGAGTGGCCGTCGCGAGTGTCTCGGCCACCATGGCGCCCAAAATGCCTTCAAACAG
ATAGTCAACGAGCTCCATGACCTGCTGGTGGTAATACACCACTCGCACTGGTTCAAAGTCGAGCTTGAGCACACTCTGGACACTAGGATCATCATGCCAC
GTGTACACAAACGCCAACAACGGATGCTGCGTTGACGACACCGTGCGGCGCCTTGAACGTTCGTGCGGCTGGCGATGAGTATCATCAGCGTCCAATCCGA
CAAGTGGCGAATACAATGCATGCTTTGTGAGGCTGAGGTCGGTTGCGACAAAGTTGCCCAGTTGCCCTGTGACTTCATTCCAGCGGTGCTCCTCATTAGA
GCCCTTGGTCACGTACTCGACGGACGCATCCTCCATTGCCACCCGCACAAGCTGTCTATCGAATTGGTCCTTGTTGAAGGTCACACTCAACTGAACCAGT
GATGCGCGTGCAAGAAAGATGGGCTTGTCACCATTGGTCTGTTGCGGTTCACTCATGGATGGGGCAAGCGCTGGATGCGTGGGCTGCGGAATGTCGATCA
CGTGGGACTGAAGCGCCGTTGCATAGACTGACAAAATCTGGTACAAGAGCGCGATTGACGACGGATTCCATTGCACGTGCAACACATTGCACCGCAGTGT
CGC