Description :
From Genome Similarity Track
Location :
Scaffold_519:13210- 15984
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.16Serine protease family S10
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.17Serine protease family S10

Sequence
2774 bases(100 bases per row)
GACTGCTGCTGGTGCGTGCTGGTTCGTGTAGCTACCTCAAGTACTGCATGGCGGGAGCGCTCACGATCGTGCTGGTCAACCTGCTGCTGACGCTGCACAC
GTCGCTGTCGCTGACGCGGCAGCAGATCGACCGCATCGTGTACGAGATCACGCCGTCCCTCGAGCCGGCGGACGAGGAGCTCGTCCTCCCGCCTGGAGAT
CAGCTGGAGTCTGGGTTCCCCGGTGCTGCCGACCAGATCGTGTCGTTGGCGGGGAAGCCTGACGAGTACATGAGCCGCCTGTTCTCGGGATATTTGCACC
TGCACAACGGTGGCGACGCATTCTACTTCTTCGCCGAGTCGCAATCGGCGAGCGAGGCTAACCATGACCCAGTGCTTCTCTGGCTCAATGGTGGACCCGG
CGCGAGCTCGCTCTCGGGGTGTTTCAGTGAGAACGGACCGCTACTCGTGAATGAGGACGGACGAACTTTGAAGATCAACCCATCGGCGTGGAACCAGCGC
GCTAACTTGCTGTGCATCGAGTCGCCTGTTGGCGTCGGCTTCAGCTTCAACACGGCTGGAGCGTACGAGTCGGACGATCTATCCCAGGCTCGCGATCTGT
ACGATGCTCTGCAGCGCTTCTTCGACAAGTTCCCGTGGCTTCGCGCGAACAATTTCATCATCTCCGGCGAGAGCTACGGCGGTGTGTACGTGTCGACGAC
GGCGCGCGCGATCGTGGAGGGCAATCTGAAGGGCGACGAGCTGAAGATCAACCTCAAGACGTTCATGGTCGGCAACGGCGTGAACGAGTTCTCGGGCCAG
TCCATCTTTCCGTACGCGTACTACCACGGACTGCTGAGCACGCAGCAGTACATGGCCGTGCGGGAGAGCTGTCCGACGCTGCAAGAGCTGCACGGGAACC
CTGTGCTGGAGAATCTCGACTTGAGCTCGGTGTGCGGTCGCGAGCTGCTGCGCGCGTACACGACCATGTTCCACGGGTACATGGCGACGCACTTCACGAC
GGGGAAGTGCGCGGGCGTGACGCAGGACCGTGTACGTCTCGCCATCGAAGAGCTCATGACCATGCACGCCAACGACGGGCGTCCGATTAGCAACCCGCTC
GAGCTGTGCGTCGACGATGCTCATCTGAACGCGTACTTCAACCTCGCCGAAGTGCGCAGCGCGCTGCACGTCGACCCGAAGGTGGGCCAATGGAGCGCGT
ACACGCTGACGGCGCCAGCCAAGCGTCTCCACGCCGCGCTGTTCGACAACACGTTCGATCCGGCCGCGGTCGACGCTGTTGCAGGCGACAGCCGCCTCAA
CTACAAGGCGAGCGTGAACGCCGAGGTGACGCCCATCTGGAAGTTCCTGCTGCAGAACCACGTGCGCGCCGTGATCTACAACGGGGACGCGGCGCTCGTG
TGCGACGTGGTTGGTGCGCAGTGGGCGGTCGAGTCGCTCCGACTGTCGTCCAAGACGGTGGCGCGCTCCACGTGGACGCTCGACAGCCACGTCGGCGGGT
ACGTCGAGGTGTTTGACGGTCTTCACTTCGTGACGGTGCGCGAGGCCGGTCTGCTGTCTCCCGTGACGCTGGCTGCCAAGGCGAAGAAGCGTCTGCTGGA
TCTGTTCGTGCTGGACTGGGCGTGAAGGGAAGCGAGTGTAGTGTGATGGAGATGCATGTGTGACGTGTGACGGACTGATTTGGTTGTTTTATTTTTGCGA
ATGGGTATATTACACAGGAGTGTCTAAATGCGTAAAATACATGCTGTCAACAGCCTGTAAACGGTCATCATGATTACAAAACATTGTAAAAATGACCTAT
TTAGGCATACAGAATGCGTGTGGATCGCCCGCACTCCTCGAGATAGCCTGTCATTTTCCAGCCAATCAGCGCTGGTGGCGTGAACATTTTCAGCTGAAAC
TCTCGCAACCGTTGAAGTCCAGCAGGATCAGAGGCCATAAACCAGAGACACTTTGGCTCTTGCCCCCCTCTGCCTGCATCGCGCAGCACCATGGCAGTCT
GGAGACGCAGCGAGTCGACGCCACTGACGGGCGATTTGCCCGTGCGGCAGACGTCGCCGGAACCTTCAAGCGGCTCGCGCGTCGTCAAGAAGTACATTGC
TCACTGATATAATTCGTTCGCATGTGACACCAAGTCGATACTAACGTCTTGTTGGTCGGTTAGATATGCCGCCTACGTGACAAGTCTGGTCGCGCTGCTG
GTGATCGGACAGATGGCGCTCACGAGCTCTTGGGCATCGCAGCCGCAAGGCCAGTGGGAGGCGTCAGCATTCCATGCAGGGTCTGCGTTCCCCGGCGCGC
AGGACGAGATCGTCGACCTGTTCGGCAAGCCCAGCGAGTACACGAGTCGCCTGTTCTCGGGATACTTGCACCTGCACAACGGTGGCGACGCATTCNNNNN
NNNNNNNNNGAACCCAGCCAGTCCCGAGAACGACCCCGTGCTGCTCTGGCTCAATGGTGGACCCGGCGCGAGCTCGCTCTCGGGATGTTTCAGTGAGAAC
GGACCGCTGCTCGTCAACGAGGACGGACAATCGCTCAAGGTGAACCCGTCGGCATGGAACCAACGCGCCAACTTCCTTTGCATCGAGTCCCCCGTCGGCG
TCGGCTTCAGCTTCAACACCTCAGGGACTTATGTGTCCGACGATTTGTCCCAAGCTCAAGATCTGTACGACGCTCTGCAGAGCTTCTTCAACAAGTTCCC
GTGGCTTCGCGCGAACGATTTCATCATTTCCGGCGAGAGTTATGGCGGCATTTACGTACCAACGACGGCGCGCG