Description :
From Genome Similarity Track
Location :
Scaffold_405:13210- 15924
Sequence
2714 bases(100 bases per row)
TGAGACAGCAGCAGGCCACTGCTACCGGGTCGACGTATACACGCCGACCCGAGGCTCTAAAGATTGACATCTCAAAGTACAAGGGAGCCGATGAAGACTC
TCTGTTGAGATGGTTCGTGGAACCAGACGATGCCATAAGGGCTCGTCATATCGTCGATGAGGAAATGCAGATCGCATTTGCTCAATCGAACTTGGCAGGG
CATGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCAAGTCCCTGCTAAGGCAAACTTTTGAGCCTC
CGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTTAGAATCAAGCAAGGTAAACGTGACGTACACTCGTACATTCAGTACATACGTCACCTTACCAGTTG
CATAACAGTCGACCCACTGAACCAATAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAAACTACCTGTTCCGATTGGAGTTC
AACACCCCAGAAGAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGCGAGACAAGCTCACGCGAATTCGAATTCCTATCGTCCGTCAAGACGACAGG
AAAATGGAGGCCCAGAACCAATAGACCTCTGTCACGCGAGGAGGGAGAGCTCTCGTGTTATAAACTACAAGAAATTGCAAAAATGCAATAGATGTCAGAA
GACAGGGCATTATACGTATGAATGCAGTTCCCCGAGCGCGGTACCACATACCGCAGGAAACAATAACCGCCAAGCGGCCAGACGAGGTCCAAGGCGTGGG
TCATCCGACGTTGTTGCGAAAACGCAACAACGTAATGGACAGCCGAAAACGGTCAGGGTCAGTAGGTGCGGAGCACCCCACTGATCCAGCAACGTCAAGT
GAGTTTGCAGGCCTCTTGACGAAGGTTGCTCCCAACACTCATTCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCCTCATTACCTTGAAACTCGAAG
TGACACAAGGCATGTCGCTTCGAGCCCTAGTCGATTGTGGGGTGTCGAACAACTTTGTACGACGCCAATCGCTAGACAACAGAGAGCTCGAATATATCAA
GCGCGAGATCTCTCCAGCGAGGATGACGGTGCGCCTCGAGACAGGCGCATTCGTAACATTGATGAAACGTGTAGTGGGTATTACCTATACACTGAAGGGA
GTCCAATACGATGATGACTTCATCATATTAGACTTCAATGACAAATTTGATTTCATCCTTGGACTGCCGTGGCTCAGAAGGTACGAGCCACAAGTCTCCT
GGCATCGACGAACAGTCGATATGCCTGTCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGAGCGCCCACAAACATGTGGGTGTACTACGAGCGA
GTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCACATGGCCATGGAGTGGCTGATCGCCACACCATGAAGCCAGATTCCGGCGACTGCATT
GAGATGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTTTAGTGGACTGGGCATGAGTGTCCTCCAAACGGACAACGCTCAAGTGACAACGAACCGAT
TGCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGTGAATCGCACGTAGAAGATCTGGCCGCGGTAGAACAATCAGCCAGAGGATAACGAGGGAGC
AATTCCACTCGTGTCATATGATATTATCGCCCAAGAGGCTAGTGAGGGAATAAGTCCCTACCCAACTGTGGAAATAAGTTCCCAGGAGACAACAGAGACA
TTAAATGTCATAGTCAATGACGGATCAAGTATAGAAACTTACCAACTTGATCTGATCGCGCCTCCGAAGACAACTTCGGAGATCATTCAATTGCCCACGC
TCGAACAAAAAAGGTTTTTGCGTGATCTGCGCATGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAAGACGAGAACGTAACCGATATTCGGTCGG
CAATGGTATTCGCTGAGAATGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTGTCCTTAATGAGAAGACTCGGATCGCGGGAACCGCTCAAGACAA
ATCCTCTCTACGATGATTTGACGAAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTGCGAGGTACCCGAGGATAAGGGTACTCGTCACGAGATCGACCT
GAAATCAGGGTCAAAGTACTAAGTACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTACTAGCGATTGAAAAATTCTTTGCCGGTCGCTTGGC
AGTGGGCCATGTGAGGGAAGGGAATCTACTTCCCCATATAGCTCTCCGACCTTCTGTGTACGAAAGGCCACAAGAGGGTGGCGTATAGTACATGCCTTCA
ACAAGTTGATTGCTGTTACTGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGTCAAAAAGTACCATCTTTTCGTCCATGGA
TCGGATGGATGGCTTCTGTCAGATCCTAATGCGTGAAAAGGACATTCCTTATACAGTAGTGAGCACCCCAAGCGGTATGCTGTGGGAGTGGCTAGCAATA
CCACAAGGGATGAGTAATAATGCCCCTGCTACGTTCAACAGATGCATTACGAACTGTTGAGATCCGTGCGAGAATGCGCACCTAGCTATTTCGATGACGT
GTTCGTCCATAGCC