Description :
From Genome Similarity Track
Location :
Scaffold_3039:1321- 3879
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_3039-abinit-gene-0.1Conserved gene of unknown function
Pytar_ATCC12531snap_masked-par_contig_3039-abinit-gene-0.0Gene of unknown function

Sequence
2558 bases(100 bases per row)
GATCCAGCATACTACCAACGTCGATCCCGATCGACTGCAACGTCTCCCTACCCAATAGTAGCTCGTCGTCGTGGTTTGCAAGCACGAGACAGCGGATGTT
CACAAGATGCAGCGGTCCAGCGGCTGTCGATATACGAACGTCGACAGTCACTGACTCAGTACACTGGGTCTGGGCACCACCGGCCAGCTCCACGGTAACC
GGCGGCTCGAGCAGGACTCGAATCATGCTCGTGTCGAGCTCACACAGCTCGCGAACCACATACTCGGAGAGGACGTTGCAGTCTGCACTGGTGTCCGCGC
AGAGCGGCACCTCCAGAACTTCATTGATAACCGCGGTTCGCTGACCCTCAGCCACACCAATAGTTCGGATTGCCTTGACCTTCTCTGGCTTCATCTCCTT
TTTGCCTTTCCAACGGCATCGAGCATCATCCTTCTGCTCAGTGGTAGCCGTCGGACAGTCGTTCAACCAATGAGCACCCTTGCAGAACAGACATCCATCA
CGCGGTGGCTCCTTGGCTTTCTTGGCCCCACCCGGGGGCTGCTGGAACGCACCGCCGCCTCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTGGCTTGTCACTGGCGCCCTTTGCCTTCTTCGGGGTGGCGCCTTCCCGCTTCACTTCCCCCTGCATTAGGTGGAAGTGCTGCTGGTAGCGCC
CACGCTCCACGATCAAATCGTATAGGACGACATCATCGGTCTTGGCCGCCCGATGCGTCAGGGAGACCAACCGCTCGATACCCAGCGAAGCACCTCTGGC
TGAATATGCTGCACGAGTATCTTGCACCGTGCCTTCATACGCTGGCGGCCATCCTCGTCATAGACCGGCCCGCAGCCGATGATGCTTGCCAGCCCATGGT
CCTCAATGATCTTGTCGAAAGCGAGGTAATACTTTAGCACGCGTGCCTCGATATCGGGTTCGCGAAGGTCCATCTTCAGGTGGGTGGCGACGATCAACCC
GACGTTGGGAACGTGATCGTTCATGAGAGTCCCAGCCTTACGGCTAATCTCAGTACAGACCGCCTGGTTCGAGACCTCGAACATGCTCTTCTTAAACACG
TAGCGACCCAGGTGGTCCAGCACTCGCGGGTCGATTGTGCTCTTCACACTGACCACCCTTTCGGGGACTTCGCCGGTGACCAGGCAGCGCTCTTGCATCT
TCTCTTCATACTGTCGGCGGTCTCTCTGGTACTGGACGAGAGAAGCGTGGTTCCACTCGGTCAACCGCGGAGCCTTGATAAACTCGAAGACCGGGGAGCG
TGCATGTCAACATCGCCGTCGCTGTCGATGCCCGACATGGTAGTTGTTCTTGCCGTAAAGATCTTTGTGGCGAATGCCAGGTTGTCAAGGCCGAACCGGT
GGCGAACCTGACGAAGGAGGGCCGCAGCCGTCAGAGCCTCGTCGCTCGAAGAGGAACCCGTGCCTAGCTCCGCCAGCATCTCGTCGACCAACCGGTCGAA
GCGCGAGGGAGGTGGCGCTGGGTGATCGGCGATCAGCAACAGGTCGCGGTCACTGGTCGTGCGATCAAGCGCCTCACCATCCTCCAACGAACCAGAGAGC
CTCAAGAAGGAACGGGCAAAGCCGATCACGGTTGCTGACAGCGGGAGACCGGCGCTGGTGACAAAGCATTTCTCGAGAGCCGTCCGGTGCTGCTGGAGCG
TAGACGTCAACAGGGCCTCTTGCTNNNNNNNNNNCTTCTCGAGAGCCGCCCGGTGCTGCTGGAGCGTTGACGTCAACAGGGCCTCTTGCTCGAGTTCAAA
AGCTTCGCTGCGCACCGGTTTCTTTGACTCTGGGATCACGCTGTCGCGCACCGCGCGCACGCTGCGTACGAGCGCTCCACCAGTTAGGAGGGCCGGTCCT
CCTCCCGCCGACGCGTCGTCCGGGCTGGCAGCCGCTGACAGCGCAGTCGAATCGTCGGGCGCCGAGCAATCTGACGCATGGGGGCTGGGCGAGCCCAGCG
TATCGCTTGCAGGCTNNNNNNNNNNTGAGCAATCTGGCGCATGAGGGCTGGGCGAACCCAGCGTATCGCTTGCAGGCTCCGCGGCGCTGGGCAGCACGGG
TGGAGACGCAACACGTGCTGGAGATGAGGCAGGCGGAGGCGCTGCACTGCCAGCAGCAAGGTCGGAACGCGTGGGAGAGTTGTTGGTGGCGGTGTCGCCC
GTCGTAGTCGCGCCTGCCGCCGGTGGCGCAGCGGTGTCGCTCGCCGCAGTCGCGTCCCCCGCCAGTGGCGCAGCAGATTCGCTCGTCGTGGTCGTGCTTG
GCGCCGGCGGTGCCAAGGAGACCGCAGCATCGTGAAGAAGCGCAAGGGGCGACCGGTCCGCCGGTCCCTCGTCGTCATCACTGCTGTCGGACGACAGAGT
GATCGCGCTTGGCGCGCCAGGTCGCTTAGGCTGGTCGTCGTCGTTGGTGCTCATCTCCTCGGAGCCGTTGGCATTTTCGGAAATGAGCAAGGGGCGGNNN
NNNNNNNCGCCTAGGAGACCGCGGCATCGTAAAGAAGCGCAAGGGGCGACCGGCCCGC