Description :
From Genome Similarity Track
Location :
Scaffold_3244:1321- 2963
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3244-snap-gene-0.3Adenylate cyclase

Sequence
1642 bases(100 bases per row)
ACCAACCGACTGGATACGATATCCGAGCGGCACTCTTTCTCGCGCTTGAAGCGATCGCCCAGCGTGTTGGCAATGACGCGATGGATGGGGAACGAGATCT
GCAAGTCGGGGCTCGCAAACGGCTCGACGGTCTGCTCCGTGTGGAACTTGGAATGGACCTTGTGGATGAGATCATTGCGCTCGTGCTCGAGGTAGCTGCT
GAGCGCCGAGTCGCTCATGATGATCTCGCCGCCGCGGCCCTTGTCGCCGAGCTCGCGAGCCACGATCTCGCTCACGCCCAAGTACGTCATCTTGCCCGTA
ACAGGGTGCTTGGCACACACGAGCTTGTCGTCGCCAACATGGATCGCCATGCGTACGCGGAGCCCATTAAAGACGAGTCGGCCCCACGCGTCGTGCACGC
GGTCGACCGTCTCTTTGCGCGCAAAATCTCTCGGCCAGTCGACTCGGAGCAGCTTCTCTTGAATGTCAATGCACCAGGCGATGGCGTCCGAGATGGTGTG
GAACGCGAGCTGGAACGCGTCGCCGACCGTCGTGATCTCGTACCCTCGGAATCGGAGCAGCTCTCGTCTCAGCGTGTCGTCATGGAGCGACTGCGCCTCG
GCCATGGCCTCGGGCATGGTCGCCCAGAGCGCGGTTGACCCTTCAATGTCCGTAAAGACAAACACGGGGTGCTCGGTCGGCGGCTCGACAATCATGTCTT
GGTTGAATAGGACCTCGTCGGGAAAGTAGCCGTTCTCGAGAAGGTGTTCGTATACGGACGACGGCATAATGGGCTGGAGCGTGCGGTAGCAGCACGTGAC
GCTGGCGCCAATGACAAAGGCCGTGCCGGCGCCCGAGAGGTAGAAGAGTAACTGGGAGATGCCGATCCAGACGATCGGAATCTCGACTTCAAACTGCACG
AGCGTCTCGACGACACACGACGGGAAGACGAGCACGCAGTAGACAATCACGAGCCGCTTGATGCGCTGGTAGAGAAGCAGAGAGAGTGGGTTCACGACCG
TCCGCGAGCGCTTTTTCTTCGAGAGCCGCAGCGTACAGCCGAGCGGGTACACGAAGGAAATCCAAATGCACAAGAGCTGAAAGTCAAAGGCCACGGTGCG
GATCGTCTCTTCTTGCTTTGGAAAAGCAAACGCCGACACCATGAGCGTCGTGGCGAACGCCGTCGCCGCGCTGTACGTGCGCACGTTGTAGTTGCGCATG
ATCTTGCGCTCTTTCTCGGCGCCGCGGTCCATGCTCTTGCGAATGAGCCTCGTCATTTCGAACGCCATCGTGATGATCCAGAACGTCGAGCACAGCAGCA
AAATGTCGCCGAGCAGCGCGATGACGAGGATCACTTCCTTGCCCTTGGCGGCCTCGCTGTCGCCGTAGACGACGTGCACGCCGAGCATCTGCCCATTATC
GATGCCGTCCAGGTAATCGCGCACGCCGTTCCAGTTGATGAGCACGCCGACGTAGAAGATCCAGCGGCTCGTCGAGTAGATGAGCATGGCGCGGCAGAGC
GAGTACAGCACGTACTGCACGGCCGACTCGTTGACGTTGAGGTCGCGGAACGAGAGCAGCAGCGTCGAGAACGTGCCGACCATCGCGACCGTGAGCGCCG
CGACGTAGGCCGCGGTCCAGTGGACATGCGAGACGATCATGG