Description :
From Genome Similarity Track
Location :
Scaffold_2495:1321- 2935
Sequence
1614 bases(100 bases per row)
CTTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGGTTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCATATCTG
CCTCGTCTACCCATCTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAACCCGTCCGTATCTAGTTCGATTCCCCGACCTCATATCGGT
GATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACC
GAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCGGTACCTGCCGTTTCCA
GCCTTATCGCGTGTTCATCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATA
AAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACC
TGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGAATGGCCTCTTCTA
GGGTGGATTTGAGATCCCATCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTCTTCATCGCGAAGGGGAGCCGTTCTGCGTA
CTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGA
TATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGC
TAGCTCCAAATCTTTGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAG
GTCCACCCAAATCAATAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATTTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATA
TTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACACTCTTGAATAGTCCCCTTC
AGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATAACCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGCTGTAAGGT
TTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCC
GTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAGATCCCGTACATCCCCCATCCCCATACAATCGTTAGTCCTAGGATCCACGCTTCCTCGTT
CTGTGCTTTGAGGA