Description :
From Genome Similarity Track
Location :
Scaffold_140:132071- 134912
Sequence
2841 bases(100 bases per row)
GTATGGCTTAAGCAAGCCGACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTGAAC
GGTCCTATGAACCGAGGTCTTAACTTCGTCTTGAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTAGCGTTTAATAAAACGTGGTCACCGACCTCAA
ACCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTCTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCT
CAAAGAGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCACCAAGCCCTGAGCCACTGCGT
GGCGGCGTCAGTGGGACGCGAGGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCAAACTCAACG
AGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCT
GCGGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCAAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCTGAGACAAT
TGCCTCAGGCAAGCCATATTGGCGAAAGACTCTCTCAAAAATCAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAGGTGAGCCATC
TTGCTCAATCGGTCTACAAAGACCACAATACCCGTGTTTCCTGCCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCT
TGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATA
CATTTTGGGCCACCAGTACATCGTGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGA
TACTTGAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGCGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCC
TCGCGCGTAAGCGCCCAGACAATTCTTTGTCAGAGTCTAGAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGC
TCCGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGGGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGC
CCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAGCG
ACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAAC
TGGATAGTTCTTCGCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCA
AAATCGGAGGCGTCAAAGACGACGCTAAGCGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTC
CGTCGTGCTCGACGTTCCAGCACCATGATGCGTCCTTCTTAAGAAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTACTTGTGCAAGTA
ATTGGCTAAGCCTAGCCACTTGCGGAAGTCCTTTTAGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGGCTTTGGCAGGATCTGCCTTTAAGCCTCGC
TTCTCAATGAAGCACCCGAGGAAAGGTATTTCCTTCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATGCACTCGAGCACCACTCGCAAGTG
GTCAATGTGGTTTTCCACGTCTGACTTTCCGTGCTAAGCACGACTATGGACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAAC
AACTGCGTCACAAGACAATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTG
TCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCAAGTGCGCTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAAC
ATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTCAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAG
AACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCACGAAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCA
AAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTCGA
GACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCC
TCTAGGATCGCGTCCACGACGGATGAGGAGTTCAACTCCTC