Description :
From Genome Similarity Track
Location :
Scaffold_612:13206- 14941
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_612-snap-gene-0.9Amino Acid/Auxin Permease (AAAP) Family

Sequence
1735 bases(100 bases per row)
GAATCACCATTGTTGGCTAAGAGAATTCCAAAGTCATTTAACGTTGAGATCTTGCACCATAACATCAAGCCACAAGTGATCGGTTTCTGGGATGGCCAGT
GTCCAGGCGTGCCATCCGGTCCGGCGGCTCTCTCTTGACCTCCACTGTCGACCTGCTCGACCACCCATACCCTGGACCTGTGTGCAGAACGGAATTGTAA
ACTCAACAGACGTACTGGTCCTGTAAAACAGTACACGCCAAAAGCGACTTGGCTCGTTTCTCGCCTCTTCATGCTGGGTGTTTGTGCAGCTGATCCTGGT
TGCTCAATCAGTTGTAGCCACCACTAATGACCTCTAACAACGCATAAACGTCGTGATTAACCAGAACACGCGACCTCCGAGATTACACCATTACTATTGA
AATCACAACCTTCCACAACACATATCGAGGCAGATCAAACTCTCTTTGCAGAAAGATAGACATACCACCACATGCTGCAATGCCCATGGGCATTAAAACA
TTACATTGAACATTTGCGTCAGTGCATTCGCGTGTCTAGTGTACTGTTCTAAGAACTTCACCATCACCCAAAAGCTGAGGCAAGCCGTCCAAGAGACCAG
CCAGCCTTCGATTGGGGCAAGAGTCTCTTGAAGAGTCTCTCATTCAGGTTTGACTGCGACTCCATCTCCAATGTCCATCCCCCTTCTCAGAGAGACTCTC
CAAAGATGGGCTCCAGCCAACGATCGGGGGAAAGCGAGTGGGTCCCGGGAATCCGCCTTCGAGCAAACCGACTCACTCGCCAAGTCGCCCGCTCGCGCTC
AAGTCTCTTCATCGGATCCCTTCGTCTTCGAGTCAAGTCTCCGCCTGCTCGCTCCACAATGGCTCCCTTTAGCAAATGGTTCACGGTCGAGGACGCCANN
NNNNNNNNCCGGATCCCTTCGTCTTCGAGCCCAGTCTCCGCCCGTTCGTTCCACCATGGCTCCCTTCAGCAAGTGGTTCACGGTCGAGGACGCCAAGATC
GCGTTCAACCTCTTCTGCTGTGTCTACGGCATCGGTACGCTCGGCATGCCAGCCAACTTTTCCCGGGCCGGCCCGCTGCTCGCCGTGCTCGCCATNNNNN
NNNNNCGCGGGCGCTGCGTTCGCCGGCTGCCTGGGCACGATCATCGCCGACGTCATTGGCGTGGCCGTGCTCATCCACGGCATGGACGGCCACCCGAGCG
TGCCATCGTCCAACGTGTCGTTCGACCAGGTCGCGACGACCTTTGGCANNNNNNNNNNACGACTGGCCGCTGGCTCGTGGTCATCTCCCAGATGGGCGTG
TGTCTGCTCGTGCCCTGTGCGTTCCTCGTGCTGGGCGGCATCCTGCTCAGCAACCTCTTCCCCGGTGCCTTTCAGGACAAGACTTGGATCGCTCTCATGG
CAATGAGCGCCATCCCCGTGTGCCTCACGCCGACCATGAAGGAAGNNNNNNNNNNGGCGCTGCAGCGCCAGCACTCGCAGCCCGAGCGCATGCCGCGGGT
CATTGGCGTCACGCTCACGTTCATTTCGTGTCTCTTTCTCGTGCTCGCGAGCACGGGCTACTCGAGTGTGGGCTGCCAGATCTCGGGCAACTTGCTCTTC
ACGATCTACCCCGACCCGACCACGAAGCTCACGAAGCTGGGATTCAAATCCGACCAGGGCGCTGTCGTGCTCGCGTACCTCTTCATGCAGCTTCACATTT
CCATTGCGTTTGCTGTGATTCTCCACCCGGCCTTT