Description :
From Genome Similarity Track
Location :
scaffold_4:132011- 133431
Transcript NameFunction/comments
Pl_112921hypothetical protein PHYSODRAFT_259509

Sequence
1420 bases(100 bases per row)
AGTAGCTAGAAAATGTATGGAAAAGATATGTGTACACTTTGTTATGAGGCTTTCGGGTGCAAAAGTGAGTCATGTTCACGAATCAAAGTTTTCTGACCTC
AGTTGACTCAACCACGACAAAGCTGATGCCGAAGCTCGAAAGCTCATGAAATGCCACAAATACTCAAATATTATTGCAGCAATTGTAGCTGCTTACAATA
GGTTTGCTCAAGCCGCATCAACGGTTCGTATGAACACGATTGGCGTCCCATGACGCCGATCAAGGGTTATGCCGTCGTGAAACCCGTGAGATCTGTCTCC
AGCGTGGCGTACAGCATGGTCTTCAACTCCTTCTTACTGTGATACAGCGGCAGATCTAGGCGGTTGAAGCACGCGTGGCTCGAAATGTACTGCGTCATTT
TGTACGACACCCCCTTAAGATTGAATGGACACAGGCGGCCATCGTAGCTCGTGAGGCCACGGAAACCCGATAGCGGGACGCAGGCTGATCCCGTTGCGAA
TAACAGTAGACGCCGACGGTACTCATTCGGCATATCACGAACAATCTCCCAGAACCAATTCGTCACGCTAGCACCCTCGAGATTAGGAGACATAACGGTG
TGTGTTTCCCAGTCCGTAACATCGATTTCAGGGGACCCACAGAGCAGGTAGTCAAACTCTTCCGGATCGAACGCCAGCAACATCTCGCGAGGAATTACTT
CATAGAGACCCGTCAGGAACGCGTACATCTGATCCGCCACACTCTCGAAGAGTACATATCGGAATCGACGGTCCAAGTACTCGCGTTTGTTGGCGTCTGT
GACGGCCACATTCCGGCCATTCGGGATCAAGTCCACCACTACCATCTCGGATTCATGTACCTGCTCGGTTAGGCTAAAGTCGAGTCCAAGATCATCGACG
CCATCGTTGTCCATCAGCCATCGCAAACTGCGATAAGTCTCCGGATCAAGGAACTCCATGTCGGCGAAAGTCACTGGCACACCCAAGATCACCTTTAGCA
ACGGCAGCGCGAGGTGGAAACCCCAGATACCACCTTCCAGCAGCGCACGACCAATTAAACGCCCAGTGGCGAAGTAATAAGCAAGGTGGTCTTCGCCCAC
CTCGGCGCGAGACTGCGGGTTAAGAAAGTAGCTCTGATCGGCTTTGTTCGTGCAAGTAAAGAGGCGAAGCGTCGGTGATGCCAGCAGCTCATTCACCAGC
ATAAACCATTCGCGGTGCACACCACCAGCATCCACTCCACTTTCATCCAAAAAGTTGATACGCATAAATGATCGCAGGTTCTTCGGCTGGATGCAGTACA
TGTGGTCCAAAGACTCTTCCAGCATGTAATCTCGATGCACTGACAACTTCAGAAACTCAACTTCCGCAGGCACAATGAGCGAAGCAGTGCTCACCACAAA
GTGAGCATACTTGGATGGAA