Description :
From Genome Similarity Track
Location :
Scaffold_825:1320- 3977
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_825-fgenesh-gene-0.3DEAD/DEAH box RNA helicase

Sequence
2657 bases(100 bases per row)
TCTCTCTATCTCCGCATGATCGCCTTGCTTCTCGTCGGCGCGCCGTGGGACTTGCCCTTGATATTGCCCTTGCCGCGCTTGGTGCGCGCGCCGCTCGTGA
CCTTGACGCCGCGCGAGCGCGCCTTCCGCTTCTCCTCCTTGCGGATACTGGTCTCGCTCAGCAGCTCGTCCTTGGCGTGCTTGTTCACGTTCGTCTTCTT
GGCCAGCTGCGGCTTCTTGCCGTTGCGGTAGTCCAGACGCTTGCCGTCGCCCGCGTCCTCGTCGCCTTCTTCGCCGCCCGTGAACACGCGCTTGTTCTGG
CGCTGCTGCCACTTCTTGTAGATCGCGCCGACCTCCTTCTTCTTGCGCACGTTCACGCCGCTCTCGTTGCGGCGCTTGAGCGTGCCCTGCGCCGTCAGCT
CGCCCGCCGTCGTCTTGACAAACTTCTTCTTACGCACGTCCCAGTGCAGGATGCGGCGCTTCTTGTTCAGTTCGATCGCCTCGTCCGGGTTCACGTCCAG
GATTGCCTCTTCCAGACGCGCCTCCTGGAACGAGTTCACCTTGCCGCCCTCGGCGCCGCGCGCGAGGAACTCTTCGGTCGCGTGCTCGCCCTCCTTGATG
TACCCGATGTAGTTCTCGCGGTCGATGAAGCTCTTCTTGCCGCCGTCGTCCTCTTCCTCGACAATGTTGTCGTCATCACCGTCTTCGCCAGTGTTAACAC
CGCTGCCACCCTCGGTTTGCTTGGCCGCCGCGATCTCCTTCATCACGTCCGCCTCCTTCTCGCCCGCCGCCACGCGCTTCTTGATCTGCTTGCGGTCGAA
CTTGGACAGGAAGAAAGTCTTCTTCTGCGACTGCTGCAGCTGCTCCATCTCGCGCGCCGCCGCGGCGTCCGCCTCCGCCTTCTGCGCGATGCGTCGCGCA
AGTGCCTCCTTGTCACTCACTGTCAGCTCCTCGCTCGAGTCCTCTTCGTAGACCTTGTCGAGCACGCCCGTGTGGTCCTTCTCGCCCTTGGTCGCCTCCT
TCTTGATGATCTTGCCGTGAAGCTTGCGCTTGCCCTGCATCATGATGACCGCAGCTGAGTTCTTCTTGGCCGAGTGCGTGCCCGAGGCGATCTCAAAGAT
CGTCTGCGGTGGCCGGAAGGTCTGCAGTGACTCAATGTACTCCACCTTCTCGGCCTTCGAGTCCTCCTTCATGTACGCCTCCATGAACAGCGGGTGGATC
TTCTTCGCCAGTACGTCCTTGGCGCGCTTGATCGACAGCTTGGACGGGTCCGCACGCGTGCGCGTGTACGCCTTGTACGCGTTGTCGCACACCTTGACGA
GTGGCGACACCTGCGGGTGGTTCTTCATCACATCCGCCATATGCTCCGTCTCCTGGTCGATCAGCTCGTTCGGGAACGCGCCGTAGTGAATGTCTGTGAC
CTGCATCGTGTCAAGCGAGTACGATGGCACGCCCACGGGCGACGAGTCCTCCAAGCGGCGACCAATGTACAGGTGGAGGTCGACCATGAACGGCAGCTCG
TCCGGGTCCACAAAGTTGAACGCCGTACCACTGCGACCTGCACGCGCCGCACGACCGACACGATGCACGAACAGCTTGGCGGTTGACGGGAACGAGTAGT
TGAGCACGTTGTTGAGCAGCGGGATATCGATACCACGCGCCGCCACGTCCGTCACGATCAGCAGGTTCGTCTTCTTGGCGCGGAACTTGCCGATGTTGAT
TTTGCGCGACGCCTGGTCCATGTCACCGTACACGCATGACGACTCGATATGGTTCGCACGCAGTAGCTCGTGCAGCAGTTCCACATGGTGTCGTGTCGCC
GCGAACACGATCGTCTGATCGTCCTTCGGGATGAACTCGCGGACCATGTACAGAAAGAGTGCCGCCTTGTCATTCGAGCGCACGGTGAAGAACGTCATCT
TGAGGTTCTCCGAGATCTTGTTTTCGACATCCAAACGAATCAGCTCTGGCTCGCTGAGACCGGCGCGCGCGAACTGCACGAGCGCCTTGGGCAGCGTCGC
CGAGAACAGCAACGTCTGACGACTTGTTGGCATGTTCTTGAGAATCTCCTGCAGCTGCTCCGCGAACCCCATCTCGAAAATGCGATCGGCTTCATCGAAG
ACCACGTACTCGACCACCTTAAGGTTGAAGTCCGGGATTTCCTGCAGGTGGTGCATCAGACGACCGGGGGTCGCCACGATAATGTCTGGGTTCGACGCAA
TCGATTCGAACTGCTGCTCCATGCCTTCACCACCGACAATGAGCGAGATCTTGAGGTTCATGAACTTCGCGAGCATCTTCGTGAAGCGCATGGTCTGCAC
CGCGAGCTCACGCGTCGGCGACAGGATCAGCGCGCGCACGCCGATCTTCTTCGAGTGCTCCTTGAGCTTCTCGAGCATCGGGATTAGGAACGCCGCGGTC
TTTCCAGAACCTGTACGCGCCATCGCCACCACGTCCTTGCCCGAGAGCACGATCGGCAGCGACTTACGCTGGATCGGCGTCGGCACTTTGTAGCCCATGG
CCATGACACCGCGGAACACGAGCGGACTCAGCCCGAGGTGCTGGAAGCCGCCAACACCGGCGCCTTTGCCGTTACTCTTGCCGTGTGTGGTGCCACCGGC
AGCCGCGCTGCTCGGCGCATTCTTCTTGGCCTTCTTGAGCAAGTCGTCGCCTGCCAT