Description :
From Genome Similarity Track
Location :
Scaffold_37:132- 7062
Transcript NameFunction/comments
g9211.t1hypothetical protein
g9212.t1hypothetical protein
g9213.t1hypothetical protein

Sequence
6930 bases(100 bases per row)
AAGTATACTTGCGGATACAAGTATACTGGACTTAAGTTAAATACTCCTACGCTTCCTCATACACGTGCGCACACGTGCAAGCTTAAGTAGTGGGTCCAAG
CAGACCCCTTACACCTGGTAGCACTTTGTAGTCCGTCCAACAACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACA
GTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTAGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAATGACT
GTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCCACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAG
CGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTTCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAAC
CTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGACTCGACGTATCGTCGACCCGTTGTCGAACGTCGCGTTCGCCATGTCATGTCTTGGCGG
ACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACAGACCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGTCC
CCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTTGA
ACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCC
GAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTACGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCG
GTGGTAAGGCCGTCGGGAGGTCCCGAACGAATGGACCTCTCGAGTGCGACGGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCC
GCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGCCGTGGCGATACTGGGTATCGCCACGGGCAATCAAA
AAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCCATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGA
GTCAATCTCACTGCAAGAAGCAAGATGACAAGCCAAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGG
TGCGTCAAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGACTAGCAACGGGT
GTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGT
TCGACATGGTGTTGGGCATACCGTGGCGTGCACGACATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGAC
AGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGATGCATGCGGCCCTCCACCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAG
CGAACGCCAACGACTGTGAGAGTCGTTGGAAGGAAATGTGAACCGAATCAGCAGGGCCTGATTCGATCGGATTCGAGAGGGTCTCGAAGCGTCCGGAGTG
ACGCGGTCGTGTCGACAGATAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAGAAGACGCGTCGGCTCTGGGAGCCGAC
GCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCAGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCG
GGCTTGAACGCGTACGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGTCTGGACAAGAAGAACTCGCGGAGCCGGGCTC
CGCACGAGAAGTGAACGGCGCAAGCGAGCAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGG
AGAAGACCGTCGAGACACTGAGTGTCTTGACGCGTACAAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTT
GATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTTGCTCGCGAACTGCACGATGGACGCACCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGGTGGCG
TGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACAAGCAAGGCTGGGACTCGC
TCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGATAACAAGGTACAAGGATGTACTCCCGGACGACATTCCGGCGG
AGTTACCGCAGGACAAGGGTGTTCAGCACGAGGTTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAA
GGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCCGTGTGAAGAAACCACAG
GGCGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACAATGCGACAGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGA
CCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGAG
CGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGAC
TTCGCACCGAGCTATTTCGATGACGTGTTCATTCACAGCCCGGCTGTGAATGAGAGATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTG
AGCTCATGCGAAAGCACAAGCTCTACGCGAACCAGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTTGGGAAGAACGGCGT
ACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCATACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGC
AAGTACGTGAGCAACTACGCGGGCAAAATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGATGATTGTCAGCAGGCCTTCG
AAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGATGCATCCGATTTCGCAATCGG
ATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGAC
AAGGAACGCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTA
CGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAGTACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAA
TGCCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGCGCAAGAGCCCGACCACACCCTCTTCGTCCTTGCTGGATGACGTGAAGGCCGCATACGC
ACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGT
TATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTTGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGT
ACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGATATACTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGT
ACGCAAGTACGTCCGTGCTTGCGAGGTATGCCAGCGTGCGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGG
CAGTCCATTTCAATGGACTTTGCTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAACAAGATGGTGCATC
ATGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTTGACCTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGA
TCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTAAACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACTGACGGA
CGAACAGAGCGTGTTAACCGTGTGTTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATTGCGGAGTTCGCCA
TCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTC
CTTAAGTGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCA
GTCATGGCGACGACAACACAGTGTCTACGACGAGCGTAGACACTTTAGACAACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGA
ACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGGCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGA
CAGAAGCTGAATGCCGATAACTCCGGCAGGGGAAACACAAATGAATTTAAAATTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAG
TTTCCGATTTCGGAGCAAGCTTGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAG
CATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGG
CGACGCGCTTCAAGGCGGCAGAGAGCCTCGTCCCGACCTCGGCCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCTACCTGAGCCTTCAACAAGCTCAG
CTCCTAACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACTCGGGGCGTCTTCCCGCC
ACCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGAA
TTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCA
CCGCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTACTAGAAGACGCCTCCGCCTGAAAACTAGCGCGCAGGGTCTTGAGGTCGTCAGATACACA
CATGGACGTGTACCCGTTAATGTCCCGTTCAGTAATGCGTACTGCCCCGGGGTAGCAGTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCG
ATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGTTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGG
GATTTTAGTTGAAGTTTTCAACAAAGGCACTCCAACTCTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCAAGAAGTCTTCTTGCTCGCAAACCA
TCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTCATCGGATCAAAGTGCAATCGCTTCGCGACGTCATCGTCAACGATGGCGTTG
CACGAGTACAGCGCGTACAGATTCGGTGACACAGTAGCACCGAACCGGCTGCTGATCTCTAACTGAGACGGCACCCACGTGGCTCAGTGCGCGAGGCCGC
AACAACAGCGGATGGAGTGGAGCCATCTCCATCCCGCGGAGTCGTTAAGGCTCCAGCGGCAGCGAGCGGTGTTCCATTGCCGCTGCGCGAACGCTTCGAA
CCCGAAGCGTTCGAGTCTTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGGCCCGGAGACAAGGTATCCTTGTCTCCTTCGAGTTCCCCCT
CCTCGACTTCACTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATGCCCACACCAGTCTCGACAGCAATAATCTTGCCTGTCTTGTTTCG
GATGGCATGTTTCTCATGCCATCTCGAGTG