Description :
From Genome Similarity Track
Location :
Scaffold_284:132- 2992
Sequence
2860 bases(100 bases per row)
TCTCGAGTATTGACGGCAGGCATAATCCAGCCCTATGCAGGGACTTACCGGAAAAGTGTACACGTGTCTTGGACTAGGAAAATTCTGCTCTGTTATCTTC
TGGGAGCCTTTTCGGCTCCTCCTATTTAATCCTATGCTTCTCATACAAATATCTAGTGAAATGTAGTCGTTTCGGATCTCTACCGACTCTTCAGGCGGCC
GTTGAGCTCAGCGGCTATCCGGATAGCATATCCGGACCGATCGCCGAGTACTTACCGTGATCCTTGGCTCCTAAGCTCTGGGTTATCAGACCGAGCCGAT
TCTTGACCTAAAGTAGGTCGGCGTATGGTCGAATCTGGAAATCCCTACACCACAACTGCCCCGGTTATGATACGAGCCGAGCTGGTGAGTGTCTTAATCC
TTCATTTTGTTCTGCCACCGTTGGTCCGTACTCGGCTGATGACGTCTCGCGGCTCCCCACCACCTTCTTTGGTACGTTCGTTGCTTCCGCTGTCACTCAC
TTGGCAGCTCCTTACTCTTCGCATGTTGTTCCAGCACAACCCGTGGCACCATCCTTCTTCTCCAACTCCTCGTCGAGGTGAAGGCGTGCCAGCTGAGTCG
ATTCCTCGACCCGTCGGTACTCGTGGGGTCAGCGACCGGCATGAAGCTGGGCTGGTTGACCTGACAGCTTCCCATGAGTCTGACGCGGAGTCGGCAGAGT
CTTCTCGCGTGCGCCTTCCTGGTCCACCGAGCTTGCCGGGCGACACCACTTCGGGCGCCACCAATCAGCCAAGCTCGGCTGCTCCAGTGAGTCTTGACTC
CCTCATGGCCAGAATTAACGAGCAAGAGCATGATCGCCGAGAAGAATTGACCTTCTTGGCGAGGCTCATGGCTTACGGATTTACTCGTTCCGTGGAGCCC
TCCGATCCCGTGCAGCGGCGAGCGATTTTTCATGCTGCTTCCGCGGGGGAACTGTTGGATATCTTGAAAGGCAACTACGCCGCTCTTGATTATCCATAGA
TCATCGGCGATCCCCAAGCTGACAATCAAGCTGTTCAGGAGGAGAACCGCGCACTGACTCGGCGACTGGACTCGCTTGCTCTCAGCAATGTCGCCTTGTC
AACTCAGATCTCGTCGGCTCAACAGCAAGTGTCTCGATTGGAGGCTGCTGCCACGCAATCGGCTAATCTCCTCGCGTCGCTGCGAAAGGCTGTAGCTTTA
TGCTCCGCGCGGTATGGATCCTCAGGTTGTTGACGACGCGATTGAAGAAGATTTCGATCTTGCTGAACAAGCGCCTCCTGCCTATGCCCCGGGTGCTCCA
ACTCGGCTGAATCGTCAAGGCATCCATATCTTCACTGAGTCTTCGATCGGTGAGCTCGGCTCAGATGGCGAGAGTGCGTCTGATGACGACTCGGCGGACG
ATGGGTTGGGTTCTCCCAATCTCCGAGGCGCGTCTCCGGGTATGTCTCCGTTCGGCACCCCACTCCCCAGTGGAACGGATCCTCAGCCCACTTCCGCCGC
GTCGGGTCCTGAGGCACCTGGTTCGGCGTCAGCTTCGTTAGCTAGCTCGGCGATGATACTTCTTGCCACGGCTGCGAATGTTGCATCTCCTTCCGCAAGT
TCCCAAGGGATGACGTCTGCTACGACGCCACGCCCCCAATCGTCGAGTCCGCTGAGCTCTTCCCAGTTGTCTCCGTCGGGGTCCAACTCACTTGGAATCC
GGATCGCCGACTTTTTAGTTTTCTTCCTTTGACTGATCTTCCCCGTAGGTATCGTTCAGGACTTCATTTCGTAATTATTCAGTATATGTAGTTTCGACAC
AGTAGCATTCCATCTCAACTCGGCCTGTGTCGTCCGCTGAGTTGGTGTAACTTTTGGTGCAATAGCTGTTAATCCTCATCTGCAACTTGCACCATTTGCA
GACGGTTTTCGCGCTTCTTCTGTCGTAGATAGTCAAACAGGAGACCCCCATATGACAAATTCGACAGTGGTTCCCAAGTAGACTCATCGTAGCCGACCCA
CTTAGCTTTAAACTTCCGTTGTGATCGTGACGTACTTGTGGATAATGGTAGCTCATCGTCGAGAATTGCTTCGACTTCATACTGGTTTGTACTTGTGTCT
GGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGATTAGCCTCGTCTTTGGTCTTCCGCCGAGTT
CGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTCCAATTCATAGGCGAATTCTTCCACCTTCTT
CTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATAAACAACCAGACTTGATCTCCTTCTTTGAAC
AAAGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATCTTTTCTCCTTCTTGCTCAACGCTTCGTTGT
GCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTGTCTGTTCGCTTCTCGGCGCCACTCGACTGC
GTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATCGAACTCGTCATAGCCTTGAGTGTAGACTTGGCGTCCCAACCATGCACCAGATAGAAAGGG
GTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTTATAGCATGTACCATCTTCTCGGCGATGTCATCCCAGTCGGCTTGAAGTGGGTCTTCCACGTAGACCC
GTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGT