Description :
From Genome Similarity Track
Location :
scaffold_62:13196- 14455
Transcript NameFunction/comments
g2473.t1 hypothetical protein PHYSODRAFT_525772

Sequence
1259 bases(100 bases per row)
GACATGATCAAGAACGAGCGCAAGATCTTCTACATGTTCATGTTCCTCAACGCGTCCGTGCTGTGGGCGTACTACTCGTGCCTCAGTGCTCAGGATTTCT
ACACGGTTCAGTTCGCGAATTCGGGGCTCGATTTCTCTTTCTTGACGACGCTGTGCACGGCTTGGCCTATGGTCATCGGCCAAGGGCTTCAGATGTTCTT
CGGCCTCGATAAGTCGGTCTCACGGGATTTCCGGGTGATCGTCGGCTACGGCATCTTCATGCTCATGGCCGTTCTGATCATGGTCTTCAGTGCTATCAAC
TTCTCCAACGAAAAGACAGGGGCTATCCTCGTTCTCGTATGCTTCGGGTGCGTTGGCTTCGGCAATTCGCTCACAGAGGCGACGTACTACACGTTTGCAG
CTCTCTTCCCGATCCCCAAGTTCTCGCAAGCCGTGCAGATCGGCAACGGTACGGCCGGCATCATCAACGTGTCGCTTCTTACCATTCTACGTCTGGCAGT
GGGTGGTGTTAAGCAGACTGGAGACTCCACGAAGCTGAGCTTCTACCTCTTCTTCGGCCTGCTTATTGTCATTCTGATCGTCGCGCTCTTCGTGTACTAC
CGTCTCAACGACCTCCCGTGCGTCAAGTTCCTCGTCCAGAGAAATGAGGAGTCGATGAGAGCCGAGAACTTGGCTACGCAGCCCTTCACCAAGACGTGCG
CCAACCTGTGGCGCATTCTACGCATCATTTGGGTGCCTGCGTTGGCGCAGTTCCTCGTCTTCTTCGTCTCGCTGTCGGTATACCCCGGTTTCGGTTGTGC
CGCTGCACGGAACTTGAAGCCGCCGTACGCGGATGTCACCCACTCGGTCACGGGCAACTGGTACTGCACCCCGGGTATCGTGGGAAGCTACAACTATGGT
GACTTTTTCGGTCGCGTTATGACTGGTGCTGCGGTCTACAAGCTTCTGACCAGCAACTGGTGCCTGGGTCTGTCCATCCTTCGCCTGGGTTTCATTCCGC
TGCTGCTCATGGGCGTCGCGGGAACGTCCCTATACTCGTTCGGCTACGACGACATGGGTGCTATCGCCTACAACATCGTGCTCAACCTGGTCATCGGCGT
AACCAACGGCTTCCTGTCCACCGTCACCATGGGCGTGGCGCCGCGCATGCTCAAACCCGAAGATCGCGAGTCGGGCGGCGCCGTCATGGCGTTCTGTCTG
TTCTTCGGTCTATCGGCAGGCTCCACGATCGGCTTCTTCTTCAGCGACCAGGGCTGGCT