Description :
From Genome Similarity Track
Location :
Scaffold_371:13190- 15135
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_371-fgenesh-gene-0.5Major Facilitator Superfamily (MFS)

Sequence
1945 bases(100 bases per row)
GAACTCAGTACTCGGACGCGAGCAGCGACTCCGTGTCCGTGGTGTCGTCGTCGAGCGGCAGCGTCGTTTTTTTCGACTGGTGCGATCGGTTAAGCACCGA
GCCGTTCTGGTAGTCGAGCACGTTGAGCAGCACGCCGACGACACTGCCGAGAATGCCAAACGTCACAAAGAGCATCTCGACGCCAGGAATGTACTTGCCC
TCGTGGTTGTACTCCTCCGCGACGGCCAGCGGGAACAGCGCCAGCCCAATGTTCTGAAGAGAAATGAGAGAATGAGGGTCAGTCTACACTGTTCTCAGCA
AACTGACCGAGTCATTCACTTGTAAATAGCGATACCTGGATGGATGTGATCGCCCCGTACGCGCTTCCGACATGCTTTGGCTCGACGATGTCTGATCCAC
ACACAGTCGTCAGTCAAGTATGAGAAGCAGCAACACCACCCACCACACAAACAATGCACAACTTACATGGGACCGATGGCCACAGCGCGGCAGCAAAGAC
ACTGTAGGACACGCCCTGTAGCACAAGCGGGATGTACAAACTCACGTTCGTAAGCCCGAGCATCACGTGCACGAGTGTGAGCGAGATCGGCGCGATGAGC
GCCAGCAGCGCACGCATTCCGATGCGGTCGACCATAAATCCCAGGAATGGTGAAATGATCGCCGATATGATGTACGGGATGCTCATGGGCGTCGCGGCCT
TCCCGGCGGCCTCCGCTTTCTTCTCGCAGTAGATCTTGGTGTATGGTCCGAACTTCCAGCCGACGCCGTCGCAGTTGATCTTGCTCTCGTCGATGAGCGG
CGGTGTAGAGCTACATTCGAACTGGTCATTTGGGTTGTTGACCGTGCAGTTCGCCGACAGATATGGGAGTGGCCACGAATATGGAGGTACGGGCGGACAC
TTATCATCGAGGCGCAAGCACTCAAAGTCGTCAATGTACGCGCCCTGGCCGCAACGACGACACTCGACGGGCGGCTCCTTGAAAAAGTCTCGCTCCATGA
GCAGGCTGCTAGCGACATTGTTGAACGGGATCACACAGCCGTACACAACGACGCAGCTGAGCGCCAGCAGCCAGAATGCCGGGCGGAAGTGGCGGATATC
GCCAAAGCTAATGCTCTGGGCGCTGCTGGTGTTGCCGTTGTTGCCGCCCTTGCGCACTGACTGCGCTGCGCGCTCCGCACGTCTGTCGATGGGGATGACC
ACGAGCACCGCGAGCGACGACATGATGCACATCGCCACGCCCACCCAGAGCGCCGCTGATACACTAGACTCTCGCGCGATCATCGGACTGAGCTCGTTAT
TGATGACGCTTCCCAGTCGAGCCACACTCAAGTTGATGCCCAGCGCAAGAGCTACAAAGTCAGCAACAAGGGCATAGCTAGTTCAATATACCACAATAAT
AAGGCGCAGTTCTAGAAATACGTACCCAGCTCGCTGTTTTTAAACCAGGACGCGACGAGCGTGCCCTGCGCGACGCCGAGGCTCTCGCCGCCAAAGCCAA
AGACGACGCGACCGATGAGCATCAGGTTGAAGTTGGACGTTGAGCTACCGATCGCAAAGATGATCTGGCCCACGAGGATCGCCATCGAGAACGCGAGCAG
CATGAGCCGCGCGCCGAAGCGGTCCACGAACACGCCGCCAAAGAACGGCAGCAGGACATTCGGCACCGAGTACAGCGTGTAGAGCAGATTCTATGTGCAC
GTTCGTCAAGCAGTAGAGCTCTCTCTCGTTAGTCGTCGAGCTATTCACACAAGCAATATACAAAAATGGTGGTGGCTACATACAAAGAGGAACTCGAAGC
GCTCCTTCGGGTACTGGTTGAAGTGCTGCTGCAGTTGGCTCTTGAGCGCCGCAGGGTTGTCGAAGCAGTAGTAGTTGCCGATCATGAGCACGCACGAGAG
CAGGAGCACGACCCAGCGCACGCGCTGCTGACTCTTCTCCATGGC