Description :
From Genome Similarity Track
Location :
Scaffold_1794:1319- 2354
Transcript NameFunction/comments
Phyta_totarag13667hypothetical protein PHYSODRAFT_249089

Sequence
1035 bases(100 bases per row)
CGTCCTGCTCATCCTCCCAGATCTGATCTTCAACTCCCGTGAGGGGACGGTGGTTACTGTGCACGAGACGGTTGCCACCGTTCTCACTCGGGACATTCTC
CCCGACTGcatctcggcgtcctcgtcgagaCTCCCGGGCACGCATTTAGTTCTGCAGGGCTTTCCTCTCGGCTTGCAATCCGCTGAGTGTGTGCACCGGC
TCACGCATCGCCGGGTCACTACCTCCTTCGGCACGCCAGAACGCCTCACTAAGTCGTtcgtcctgctcctgctcctccatggcTTGCAGCCATGCACCGT
AACCGTCTTCAGCCAACTTCAGCGGGGATCGTCCTCCTGACGTCGTCTCAAACAAGCGCCACAGGCGGCTGACTATGCCGATCACCATCACTAGACCGCT
CGCAGCGGCGACttccttgtcgaacacgacTCCGTCAACGACCTTCAATCCTTCTTCGCACATGAAATGGTAGTTCACCGCGCTCAACAGGACAAGCACA
CCTGGTCCTCCTTGACTAGCCCATTCCGCAATCTCGTACAGGAACAACACTCCGTAGAAAACTGCATAGACCAGGAGAGACATAACCGTCCAGGTCGCGC
GACCAGCAAAACATGCACGGCCAACCGTCCTCCAATATTTCAACTTCAATCCTTTCCCGTGTTTCACGGTTGAACACCAACCGTACTCCATCGAATTAGG
GAGAAACACACACCAAAAAGCGTGAAACGGATCAATCCACTTGTAGAGCAGACGCCCTAAGCCTTCTAGGTGATCATGTCttgcctccagcaccaccatg
gGCTTGGCCCACAAGGCGTCAGAGCTCTTCCACCACCTTTCACCACGGGGCAGGCCCTGAAGAGCATGTCCTCGAATGTACCGTCGGTACCGATGAATAC
ACACTTTCGCAAGTCCGGCTCATTTGGATACGGCGTAACTTAAGGCGGAGAACAGTCTAATCGCAACGGTACGGAGCGGTTGAGTGACCGTCCACACCAG
TGCACCGGTCGTTAGCCACAGTAGTTCGCGCCAAT