Description :
From Genome Similarity Track
Location :
Scaffold_31:131849- 133266
Sequence
1417 bases(100 bases per row)
GCCCATGTGCCGTCGAACTTCTTGCCCGTCGACACTCCACACGCTGTCGACATGGAGACCGCAAACGCGACGTAGTCGTAGTCGTCGTCGTTACGCCAGT
CGATATTGTTAGCACCGCGGCCACCTCGACCGCGTCGTGCACCTCCTCGGTTTTCATCCTTCTGCTTGGTCCAGCACTTGTCAATAACGTGCCCCAGTTT
TCCGCAGTAATCACACCGGCGAGTTTCACGCTCGGCGTTGAAGGCCTTCGCTGCTTCCTCGATCTTCACCGCCGCAGTCTTCTCGCCTTGTCGCTTGATA
TGCTCATTCGTGAGCACCTTCACCACATCTTGCGTTCGCAGCTCTGCATTGCTCATCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTGGGCAGACTGC
GCAGCAAGCAGATCGCCACATCCTCGTCCTCCATCTTGGCGCCGATACTGCTGAGCTTGGCGCTGATGTTGAGGACCTCGTTGCAATGGTGAAGGATGTT
TCCGCCTTCTGCCATCTCCATGCTGAAGAGCTGGCGCTTGAGGTAGATGCGTCCAGCCTTCTGCGATCCACCGTAAAGGGTACGCAAGCGCGCCCACGCG
ACCCAGGCTTCCTCGTAGTCGTCGACAACATGATGGTAGTCTGCGTCCATGTGGAGGAGCATGAGACCGAAGGCGACGTTGCTCGACTTGACATACTCGT
CCTTGGCCCTGGAGTCCGTGAACGTGGGCGTCGTCTCGCGGTTCACCACATTCCACACCGACTTGGTCAGGAACACGCCACGCATGTAACGGCTCCACGT
GGCGTAGTTCTCGCCGTTGAACTTGTCGATGGATATCTTGGAATCTTGCACAGAAGACATCGTACTTGGGCTCATAACCTGAAGAAGGTGATGGTTGGAT
CTTGTGTCTTGCGAGGGGAGGACTGCCGAAGCTTGGGGCGAGGAGGCCGAGGCGACGGAAGTCACTTGAGGGGCAGAATGAAAATTCAGAAGTGATTGAT
TGATAAGAACTTACACTGTCTTCTCTACCTAGTTTGCATCCAATCATTTGGTGCATCCAATCATCAACCCTCTGTACTCGTCCAATCATCCTACTCGTCT
AATCATCGGTGGCGTAAACATCCTACCGTAATCATCGCGGGATCGTATTGGATTACCTGCAACACAATACGATCCCGCTGTGATTATGGTACGTTGTTTA
TGCCACTAATGATTGGACGAGTAGAATGATTGGATGACCTAGGTAGTGAGGACAGTGTAAGCCCCGATAAATCAATCACTTTCGAATTTTCCTTCTTCCG
CTCAAGTGCCTTCACTCCGGTCTCCGCACCAAGTGCAGAAGTCACTCCGTTCAGTCCCAAGCTTCGTTCCAACACCTCTACACCATTAACAGGTTATGAG
CCCAAGCACCATGTCCT