Description :
From Genome Similarity Track
Location :
contig_51:13181- 15448
Transcript NameFunction/comments
g10552.t1hypothetical protein

Sequence
2267 bases(100 bases per row)
CACAACGAACTCGTCAAACACCTAAATTCAGTCCGCTACCTGCATGTAGTTCGCTGCTATATCTCGGCTGCAGATGCATTAGTCACTGAAGCTCTAGACG
CCATGGCAGGACACGTTATCCTCAGTGGAGATCGAAAAGCAGAGCTGCGAACGCTAAACCGGATCCAAGAGAAGCTGTATGCCGTCACAGACCTAACCAA
AGGAGAAGAAATTCGTGAAGTCTCAGCGTCCACTCGAAACCAACCTCGCCAGATTCGCCGAGTCAGATTCGCTGGGGATGAGCAAAACGACTCAGTGAGT
GAACCACCAACGCCAGTAGCGTTAAGAGGAAACGATTCGTCGAGGCTCACCGACGATAGCAATAGATACGACTATTTCGAAGCAGTGTACAAGCCTCCAG
GAACTCAACGAGTGGTTGAACAAAGTTACACTACAATTGAGCGACAAGAGTCACCAAGCGCCCAGACATTGATCCGTTCGTCGTTCAGACAGAACGGCGG
GAACGAATATCGACAGCACAAGACGAAGAATGCAAGTGGTCAGACCTTAAACAATACCTGCGAGGAGAATTCGACGAGCTCACTCGACGAAGAGCAGGAA
ATGCAGGCAAAGTTGCTGACCGCTTCGTGCTCAGCGAAGATGGCCTACTGTACTATTTGGGTCGCCGACGAGAGCGAAGAGAACCCAGCGAAGAAGACAT
GAAGCTGAGACTGGTAGTTCCGACCACGCTCATCGACGAAATCTTAGCGAATTGTCACAACTCCATCGAGGGAGGACACCAAGGAATTGTGAGAACGTAT
CACCGAGTGAAGACAGACTACTATTGGATCGGATTGTATGCCGATGTGGTCAAGCACGTTCAAGCATGCGAAGACTGCAATACCAGCAAGAGCAAACCCC
ACCTACGAGGGTATTCACCTGGTAACGTAGTATCAGACAGACCATTCCAGATCGTGTCCATGGATTTCGTTATTCCACTACCAAAGACTCAGCGAGAGAA
TACTGCACTACTCCTCTTCCAGGATCATTTCACTGGATTCGTGATCGCCAAGGCAATGAGCGACACAGGGGCACTTGAAGTAGCAAAGGCATTTGAAGAA
TGCATTTTTCGTCGGTTCGGAGCTCCTTCGCTCATTCGACATGATAGAGATCCAAGGTTCATGAGCGAAGTCTTCCAGACGTTTTCTGAGATGATGCAGT
CTAGGTCACGAGCCACCCTGAGTTATCGACCTCAAGCAAATGGTCAACAAGAGCGTAGCGTCAAGACGATGATCCAGACAGTACGAGTCTACGTAGAGGA
CCCGTTACAAGCTGATTGGGATGACATCGCAGAAAAACTCGTCCACGCTATCAACAACTCAAGAGATTCGACTCGGCGAGAAACGCCATTTTACTTGGTA
CACGGCTGGGATGCTCAGTCTACACTCAAATCGATGACTTCATCCATTCGCCGGGCCTCAAAAAGCCCAGCAAAACAAACGACGTCAGCAAACGCTAAAG
AATGGCGCAGAGAAGCAAACCGGCAGCGAGAGATCGCGCTCATTCTTGCCAAGGAATACCAACTGAAAGAAAAAGCCCGACGAGCCAAAGAGCATAACGA
ATCGTTGAGCCGAGTAGAACAGGGAGCTGTTCCTTCAACGAGTAACGAAGACAAGGGACAATTAGACGAGACAAACTCAGCGAGGGATGACACAGCAACT
GCAAGTGCGAACAAAGAATTAGCTGAGTCCACGCGGTCAACTATTCAAAGAAGGAGACCAAGTCTGGTTGTTCATGGAACGGGTGAAACCCGGATTGAAG
AAGAAACTTGCACACCGATGGCACGGACCTTTCCGGATCAAGCACAAGGTAGAAGAATTTGCTTACGAGCTAGAACTACCGGACAAGAGTGGCTATCGAT
TCTACCCCGTGGTTCATGTATCTCGACTGAAGAAGGTGACTGAGCTCAGCGAACGCCCCACGACCCAGCTAGTCGATGGTCTCAGCGAAAACGATCGATT
TGACTTCGACGAGGAGCTGCTGCCGGAAGACAGCTGGGAATCGGACGAACGAACCGGGCGATATGAAGTAGAAACCATTCTCGATGATGAAATGCCGCTT
TCAACGAGTACCGACCGAACTCAGCGTCTGTTCAAAGTAAAATGGGTGGGATATGATGAACCCACGTGGGAACCCTTGTCGAATTTATCATGCGGAGGCC
TTCTGTTCGATTACCTTCGCCAAAAGAAACGTGAAAACCGTCTGCAAATGGTGCAAGTTGCAGATGA