Description :
From Genome Similarity Track
Location :
Scaffold_22:13180- 15125
Transcript NameFunction/comments
Phyag_g625dehydrogenase
Phyag_g626hypothetical protein PHYSODRAFT_320486

Sequence
1945 bases(100 bases per row)
caccaccgtcacttCAATGCCGAGCGACGCCACTTCCTCACGTAGCGCCAAGGTGATCCCTGCAATGGCAAACTTGGTAGAGCCGTAGAGTCCAATACCG
GGGATCCCCTTCCAACCTCCAGCCGAACCCACATTGGCCACAACACCAGATCGTTTCTCACGCATGTGCGGCAGGACAGCACGCAGGACGCGCAGCATGC
CGAACACGTTGGTGTTGTACtggtccagcacctcctgctcACTGAGTCATCGTAAAGTCAGAAATCAAGTCGGAGGACATCACCACAGTAGCCTTCAAAA
AGTGTAGGTATCTCTTGCCAAGAGCTCAACGCACCTGCACTCTTCAATGGCGCCTTCCAGCAGATACGCCGCGTTATTGACCAACACGTCGATGGTGCCG
TACATGGCCACCGCTTGGGCCGCCACCGCGTTCAGTTCGTCCTGACTGGCCGTCACATCCAGCGCCAGTGTCTGGGCGCCTTTCTTCTGGAGGTCCGCGA
GCCGCTCCGGGTTGCGAGCCGTGGCGATCACGCAGTCTCCGTGCGCCAACgcggccagcaccacctcacGCCCCAATCCAGAGGCACAGCCCGTCACCAG
CCACACTTTGGCAGGGACAGCAGTCATCGCGCAGAGTCTTCCAGGGCCAAGGTCGATTGGCGAATGGCCCAGATGCAAGAGAGCTCTCTATCCGGCGACA
CCCAGCAGTCATGACTTGCTTGGTCTCCATGGGCATCAAGTGCTGAGTCCTTGTGAAGTGTTAAGCGCGAAGGTTTTGGCCAATCGCCAGGGTGGAGCAG
ATCGTCCCCGCGCAATCCTCATGACGCGGCGTACGCGTTTGCTGACACCGCATGGAGCTCCCTGGAAGACCTCGAGCACGACAAGGAGAGGCAAGGAACG
CGTGTGTACCATCAGCATTAATCAGGGGTCTTAAACTGCTCGGTTGGACTACACGACCTCAATAACTACGGCACCGTGACCGTGGTACTGTTGTCGAACG
ACGCGCcggtgaagttgctgccgcagacgctcaagatgctggtggagaaggcgttgaCTCCTGCTTGTTGTAGCTGCGCCTCTCCTTCGACGAAGATCAT
GGCCAAGCCGGCGTCCAAGTGCCAGTCGATATGGCAGTGCATCATCCACACCCCTGGATTGTCGGCCTGCAGACGCAACACCACATAACCAACACCCGTG
CAGGCGCCGGTGTCGTCCGTGGGGCACGGCGGCACAGTGTACACGTCGCGGAACATGGCGCCCGTGAGCTTCAGCGACAAACTGTTGTTCTGCACTTGCT
CCAACGTCGCTTGGCCACTGCCGACGATCGACGGCGAATGTCCGTGCATATGGAACGggtgctgctcgttctgCTCGTTGGCGAGGACGATCTCCACTTG
GTCGTTGTAGAAAATCTGACGCGCGTTGGTCGACACGGGCAGGTCTTCCGTGGACATCCCGCCCGCAATGGTGAGCAGAGGGGCGAATTCCGGAACGAGG
AActggttgaagctgctgccgtcgatAGAGACCTGACCGAAGCCagggaagaagaacgcgacgATCCCGCGGTCGTCCGGCGTCTCTGGCAGGGTGGTGA
CGTTCACGGGCGTGAAATCGAATTCGCCGACTGTGGTTGTTTCGTTCCAACGCTGCGAAGTAGgctccgagtcgtcgtcgtcttcgtagTAGACGATCGC
GAGTCCGTCGGCGTTGAAGCCTTCGCCAGCATTGGCGCCGGTGGCTGCAGTCCACGGTAAACCATTGAGCCCCGTCGCTCTCATCCAGAACGAGCCGATG
GGTCCATCTGAAGCGttcttggcctgcaccagcagatcGTAGCGCTGTCCGATGTTGATGGTGATGTTGGTGATCAGCTCCGAGGGTTGGAGCGAGTCTC
CGTCCGCTGCAATGACGCGGAactcgtggtcgtcgatgctaAACG