Description :
From Genome Similarity Track
Location :
Scaffold_1914:1318- 2720
Sequence
1402 bases(100 bases per row)
GCCCATTCCACGTAGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATC
GCGTCAGCTGAGGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTTCCGAATGTATCCACTCGGAAGCAAACCGTTCGTG
GTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTTGCCGCACATCTCGCAACGGATGACGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCC
GGGTTAAGTACAAACCCGGAAGACCCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGC
CATGCGATCGAGCACCCCAACATCGTCACTGTTGGACGATGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAACTCTTGCTGGCCTATGGCTCAGCG
CCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCCGTCGACG
CCAACGCGGACCGCATTGTCGTCCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGT
GAAGACATACCTTTATCTCACGCGGGACTTCTACTGGGCCCACCAGTACAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAG
CCTGCGCCTTCCGCGCAGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGAGTGTTGGCAGTTCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACA
GCCAGGGGAACACGGGCATTGTGATCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCACG
TCTGTTCGTTGACATAGTGTTCAAACCCCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTT
ACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTCCTTAAGA
GCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCTGATGGCGGCGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTA
CGTGAATGCCATCAGGCACCCACGCCCCCCCGAGTCTACTCGGGATGGTGGCTCCTTCATTAAGTGGGGGAGGATCTACGACTGCAACGCAGGAGCCGCA
GA