Description :
From Genome Similarity Track
Location :
Scaffold_5:1317934- 1320797
Transcript NameFunction/comments
Physo_56261312-oxophytodienoate reductase, putative
Physo_508984myosin, heavy chain 10, non-muscle

Sequence
2863 bases(100 bases per row)
TGCCAACCTTTGAGTTGTTCTTGGCGGAATAACCCCGGAGCCCCGTAGTATCCGCGAGCGGTTGCGCTGATGTTCGTAGCCTCCGTAATGAGCAGGCCGC
CATCCGTGGCGCGCTGCTGGTAGTACTCCTTCACGACGTCAGTCGGCACGCCTGCATCGCCTGAACGGACTCGGGTGAGTGGGGCCAACACCACGCGGTG
GTTTAGTTGGATCGGGTCCTTCTTGCCGCCGAGGGTGAGGTCAGAGAAAAGCTTGGGTGTGGAGGCCATGGTCGAGTTGGTAGGTTGCTTGGGGCTAGGA
GGAAACTTGAAAAGTGAGCAGCACCAAGCAGAGAAATTGACTGGTGATTGACAGGAAGTGATCTATCCCCGACGGCTTGCGAATCAAATAGGTACTCCCA
CCGTCTCAACGGTGCGCTGATATATTTCCGCGGGACCGTAAGCATGAAATCCAAATGCGCTGCGGTTGGGAAAATGGCTCCGTAGCTTTGGTGTCGATTT
GAACGCGGGCGGCTGAGCATGCATGCAATCGATAGGCAATTCATCTAATGAGCGCCAAGCATGGTAGGGGAGAGCTCTGTGCATGGTGAAGCTCCTGTGA
GCAGCTCATCTTTCATTTGGATCGAATGCGCTCCGGATACTGTCGAAGTGATCGCTTGCGACAGACTCTAGTGACTACCGGTGCGTATCCTTACCATTCC
CTTGCTGATGGAACTTTAGATATCATGCCAGCGTGACACAGTAGCAACGTTAGCACCACTCGTACCCCCGGTTAATTCAAATGTGCAGCATTATTGTATC
GTGCAAGCGCGACTCTTTTTCTGCAAGGCTAGCTTCTCTTCTTCAAGCACGCGTAGCCTTCGTTGGAGCTCCTCGCGCTCTTTTGCGTCGCTTAGCGCAC
GCTGCTTTAACATCTATCGAACCACAAAATCGATCGAAGAGTAGATTAGATAAAAGTCCACCGCAGCAACGAACAACAACTCAATTATACTCACTTCGAG
AGCCTGGTCGGTGGAGGTGATGTTGACCTGAAAGCGCTGGGCGTTCTCATTTGTAGCTTGTAGCTGGTCCTCCAACTGCTTGCGCACTTGCTTCAGCTCC
TGATTTTGTTGATCACGCGTTGCTAGTTCGTGTTCCAACAAGGTTCGTGCGTGGGCCTGTTCACTTCGAGCCACTTCAAGTTCTTGCGCGCGTTTTGCAT
CTTGCTGTGCTTGGAGTTGAGTCTCTAATCGCTCACGGTCTTTTGCCTCAGCTGCAGACTTCGCTTCCGCGAGCTCCGCTTCAACTTGCTTTCGACGTCG
TGCCTCCTCGGCGGCCGCAGCTTCGCTTGCTGCCAAGGCTGCATCGCTGTAGTTGACACTGGTAAGCGTGGGCGCTACAGGCTTCGCTTCAACCTCTTTT
GCAGCAGTGGTCTCGGGAGAGTTTAGTGGTACCAACAGGAAGGTGAACTGCAACATTTTGGCGTCTACTTGATCGATCAGCTCGTCCGTCACAAGGAGCT
TTACAACCTGCACGCATCACATGAATCACGCTCAATACTCTGGCCGTTTAGGTAGTGATAGCAACAAGTTTGAACATACATTGGTGTGATCGACCGGGAG
GCAAAAACTTTCACTTGGAGGGGAGATTTGGTACTGCACTCGCAGTGTCTCCTGAGAGTCTTGCGCATCAGGTACGATGAACGAGAATGGCTTGCTTTTG
CCAAGGGGCTGAAGGCGAACTAGGAGCCACACGTAGGTACCTCGCAAGGAGCTCAGCGTTCGGTCACTATCGTCGGACTCATCCTCTTCAGACTCCACCT
TGGTGTCCTGCAAGTCGAACTTGTACTTGTCCACTGATCTGTTGCTTGGAGATAGGTGGCGGTGTGATGGCACTGCACTAGTGTGGATCGGGGCTTCTGC
GCGCAAGAAGCCACTCAACAATTCGTCACGCTCCATTAGCGGGGGTCGAGTTGCCGCACGCAAATGCACGTGCACGGCTTCAAACGGTAAAACTGCTGCC
GATTCCTCCTCACTCACGACGGCCACGTCGGTTTCGACGTCAAACATGTAGCGCAGCGGCCGTAGGAAAATCGCAGCGCTTCCCACAACACGAGTACACT
CATGTGGGCCGGAGGTCATGGCCGAAGAGCACCAAATCCCCAGCACACTCTCAATTTCCCGACGCAGTTGCCCGTCCCGGTCCTTCAGCTATCTAAAACG
TTGCAATCACCAAGAATAAACGGCTGAAAACAGGTTGGTTCTGGGCGTGGCAAAACTCGAGTACGGTTCTCTCACGTGCTTATTGTAATACAAACTCATC
GCCCCATGCTTTTCGTACCTGGCGTTGCTGATTTTTTTCCTACTAATACTGAATGCGGCTTTTTCCGCGTGTTGTTCTGCGCGCATGCGCCATTTTTCTC
GAAATTTTTTCCGTCTTGAATCTGGTGAACAGCGCCGTGGTTGCCTGTGCTTTAGCTCTTTCTGTTGAATGGCCTCGAGTACCATTTGCTTCCTCTCTCG
TTCTCCGTGTCTCCGATGAACCTCATACCTTCTTCACCTGTCCGTCGAAGACTCGTTTGAAAATGAAAATGACAGCGACTGTGCAAACGAGTTGAACGTC
TTGGAATGTGCGCGGCGCTTCTCAGGGGAATCGAGTGCCCCTCGGAAATACGGCGGTGGTAGCACCGCAGTGGGCTTGACGAGCGGTACGGAGTCGTGTC
CTGGCGAGACCTGAAAGTTTCCCCGGAGCATGTTCATCTTCGGCATCGAAGTCTTCGAGCCACTAGCTGTCATCTTCTCCAACTCATCAGCTGGGGACAA
CGATCGCATCATCACTGGCATCTCGGGGTGCCCTGAAGCTCGCGATGTTGTCGACAACGGTGT