Description :
From Genome Similarity Track
Location :
Scaffold_1:1317530- 1324684
Transcript NameFunction/comments
Phyin_T30-4PITG_00203Mitochondrial-processing peptidase subunit beta
Phyin_T30-4PITG_00204Kinesin heavy chain%2C putative
Phyin_T30-4PITG_00205Putative uncharacterized protein

Sequence
7154 bases(100 bases per row)
GATTCAATTTTCTTTCCACTCGTATATGCGTCTCCCTGTGGCAAAGTGGCGTACGGCCCGTCCGCTTTCCCAATTAGAAAACTCTCGTGATTATCTCGTT
TCTCAGCCTCTATGCCTCATTCCCCCTTCTTTACGATGTCGGGATGCAGGGACGACACAATCCGCTTAGTATCGCAGCCAGTACGAGCGACGACGGATGA
AGTTGTAGTCCGGCAGCTCGTGGATAGGACCCGTTGCTGCCAGGGCGTGCTCCTTGTCGTTAACGACTTCGTCAGCGGTCTTGCGGACAGCAGCAGCGTC
CACGGCGTCAATGCGAGCAAAGATCTCAGCAGGGGTCATACGGCGGCCGTACGTCAGCATCTGGCGACCGATGTCCTCGCAGATAGGCGACGAACCGTCC
AGCTGCATCAGCATGTTGGCCTTAAGCTGCGTCTTGGCACGCTCAACCTCGTCATCGGTGGTCTTGTGTACCAGACGCACAAGCGCCTCCATGGTGTACC
ACGTCAGGTCGTTCAGCTTGTACTTGTCAGCGACAGCGTACACACCGAAGAGACCAGTGTCCTGATAGCACGTGTTGAAGGACATGTACGAGTGGGCAAG
CTCCTTCTCAGCGACCACCTGGCCCAGCTTAGAGGACATGTTCATGCCGGCACCCGAAGTGCGGTCCCAGCTGCCGAGCAGCGTCTGCATGATCAGCAGG
GGGAACGAGTGCTCGCTAGTCCAGCTAAAACCTTCAAAAGCAATAGCAACGTGAGCTAGCGGCATGCTGTCGTCCTTGATGCGTACGTCGGAGCCGAGGA
AACGCACAGGCTCGAGCGTGGGGGCGACGGCAGGAGTCGTGGGCAGGTCGCCGAACGACTTCTGGGCCAGCTCCACCAGCTGCGAGTGGTCCACAGCACC
AGCACCGGCAATAACCATGCGCGGAGCGGTGTAGTGCGTGGCAATGTAGTCCTGTAGGTCCGACTTCTTGAGGTTGCGGATCTAATAGAAGCATTAAAGG
AGTCAGACACTCTGTTATACTCCTTCAACAGGCTTTTCTACTCCACGTACGTTCTCAATGGGTCCCAGGATGGTGCGTCCGAGGCCGTTGCCCATGAAGG
CAGTCTCGTGCAGGCGGTCGAAGATGACCTCCTCCTGCTGCTTGTTGACCTCCTCCATCTCACGCAGGATAACGTCGCGCTCACGCTCGATGGCGGCTTC
ATCCAGCTTGGAGTTCTGCAGGATGTCGCTGAGGATGTCCATAGCACGCGGCACGTCCTTCTTGAAAACCTTGGCGTAGTACACAGTCTGCTCACGGCTC
GTGTAGGCGTTGAGGTGGCCGCCCATGTTCTCAATTTCAAGCTCCAGCTGCTGCTGCGTGCGCTTGCTCGTGCCCTTGAAGGCCATGTGCTCCAGGAAGT
GGGCAGCACCGTTGTTCTGAGCCGTCTCGTAACGCGAACCGGCGCCGATCCACACACCCACAGTGGCCGTCTCGCCGTGCGAGCCCTCAGAGGCCACACG
CAGACCACTGGGCAGCGTCGTCACCTCAGTGGCAGGCGCGTTCAGCACGTACGACGGGTAGTTGGACACGGCGGCCGCCACCGACGACTGCGCGCGGGTA
AGCGGCTGGCGCACGAGGCTCAGCTTGGACATCATCTTGCTGCTTCTGGGGGGCGAGCTTTCAGGCTACGAATGGGAGACCACCAGTACGCTTTCGAGGC
CTCACGTTTGGTGGGGATTATTTCCAATTTATAGACCGATAATTCGCAAAAATAGAGGTGGACGGGCACAAAGACGCTGACCAGGCACGCCTTAATGAAC
ACAAGCTGCCGATTTGTTTGGCCAGAATATGTGATGGGAAGTGCTAGGCAAGTTTCCGCCCGAAGTACTGTAGACAAGGCATTGTTCTGGTGGTGCTTTA
AAACACGCGCATGTATCTACGCACAATTTGTTTGCCTTGACACAAATGCTTGGGGCAACTACGTGTAGCTCAGTAGGCTGATGTGTAGGCTATTGCATTC
TCACAGGCATGTATGAATGCATGTAAGAAATACAAACTTGTGCTACCTATTCGCGGACTCGAGCAAGGGTTTTATAATGTGCAAATATTGTACCTTGATG
ACAATATCAGGCAGCATCACTCACGCCAGCTAAGGACTTTTCAATGTGAGAGCCTTTACTGCAGCAACGAAAGATTATGATCTTTTGGGAGCGAGTGTGA
CAACGTATTCCGGATAGTATCTATACTTGTAAGGTGCTTCATCGACATGTAGATACACTGCTTGCGGCAAAAAGTCTGTCCACAATCGTCTAAGGAATGC
AAGGGTTTGCTACCACTCCTTATTAATAGCTATCAGTGATAGCCTATCACCACAGGGCATTAGATAGGATGGCAATCAGTGCCGAGGATCAGATCGGAAT
CAGATAGTCATCAACACAGCTTGAGATTTCCTTTCCTTTGAATCCGTCATGGGTTCCGCAGCGGAAACCCGCGCGGGCATCCGCGTATGCGCGCGCTTTC
GTCCGCAGAACAAGCTGGAACAGAAGCACCAGGCTGTGGAATGTGTGCGTCTAGAAGACAACACTGTTGCACGTGTGCACAGCGAGGCTCGCGGCGCACC
GGACGATCACACGTTTACCTTCGACCAGGTCTTTGGAACCAAGTCCTCGCAGCTGAACGTATACGAAGCGACCGCCAAACCGTTAGTGGAGTCTGCCCTG
CGTGGCTACAACTGCACATGCTTCGTGTATGGACAGACAGGGTCGGGCAAGACCTTCTCCATGGATGGTGTACCAGGCGACAAGGACTACGAAGGCATCA
TCCCACGCGTCATGGCCGATATCTTTGACGGTATCCAGAGCATGCAGGCAGACCTCGAATTTATAGTACGAGTCTCGTATATCGAGATCTACATGGAGAA
AATCCGCGACCTACTCCAGCCCACGTCGACAAACTTAAACGTGCGCGAAAGTCGCGAGCGTGGCGTATGGGTTGCCGGTGCCACGGAGGTTTGTTGTGCA
TCCGCAGAAGAAATGCAGTCCGTGATGCGATTGGGAGGAGCAAATCGAGTCATTTCCCCCACCAGGATGAACAGTGAATCCAGTCGAAGCCACTCCGTCT
TCATTATCACTATCGAGGAGCGGAACACCGCAACAGGGTCAATGAAAAGTGGGAAATTATTTCTGGTCGACTTGGCAGGATCGGAGAAAGTAGGAAAGAC
TCACGCTAAGGGCCAAACGCTAAAAGAAGCGCAACACATTAATAAGTCGCTCAGTGCCTTGGGTAGTGTCATGAACGCACTTACGAGCGGCAATGCCAAC
TCACACATCCCGTACCGTGACTCAAAGCTGACTCGACTGCTGCAAGACTCACTTGGAGGTAACTCCGAGACGACACTTCTAGTGTGCGCGAGCTCCAGCA
GCTTTAACAGCGAAGAAACGATCTCCACTCTCCGGTTTGGTACTCGAGCGAAGAACATTAAGAACAAACCAAAGATAAACGAAGAGCGAACCGTGGCAGA
GTACAAGATACTTGTGGCCGAAAAAGACAAGCGCATCGCCTCATTAGAGGCCCTTCTCCGAGAAACCAAAGCCAGCAACACTGACGAACCAGTCGATTCT
TCAATGGAAGATCAGTTGAAGTTACTTGCAGCCAAGGTGGAAGAACTGGAAGACGATCAAGCCTCTAAAGCAGCAGAAATCTCCAGCCTTGAAGACCGAT
GTGTCGAGTTGGAAGCGAAAAGCACAAATCTCGAAGAAAAAGAGCGCGAGATGTCATTATTTGTTGGTCGAAACGAAGATTTCAAGAAGAAACTGGAGCT
CCTGCAAAGTGAACTTGAGGCAAAGGCAAAGGAATGCGAAGAGCTGAATGAAATGCTGACACGTCGGAAACAGTCTAGTGTGGTGGAGGCGCCTCCGTTA
TCGGCTAGTTCAATCAACAGCGAGGCATCTGCGCAGTCGCCAATCGATGAACACAGTGGGAAAGTTATCATCGACTCTGTAGTGATGGAGCATTCAGATG
AAGGAGGATCGGTACTGGAAAACGAGTTTCTTCGTCAACAGCTAACTGCAAAATCTCATGAGCTGAAGCTTTGCACAGTACGTGTTGATACATTGATGAA
GGAATTGACGAGCTGCCGTCGCGAGTACGACGCTCAGATAGAGGAGCTTCAGGAGAAGCTACGCAAATTTGATGTCCACGTTCGAGGATTTGGAAATCAA
GTGCCGCAATTGAAGTCGCTAGCAGCGAAAACGAAGATGTTGCGGTCTGTTCGTGGCGGTACTCGATCAAACTCACAAGACATGAGATTCGATACCAAGC
CTGACGACAATAGCACTGGGCTCGACAAGGCGCAAAGCGAATGGAAATTGGATGATGAAATATTCCCAGTCGCGCCGATCGATATGGAGTCGGAGGTTGT
CCAGCGATTGCTTCGTAATATGCCTGAACGAGGTCGAAAGAAGATCTCAAAATGGTTGGGCTTCGTGCTGGAAGGACGAGATATTCGCTCCAACTTCCAC
CCCGAGATTTCAATTAAAGGAATCAGCGAAGAAGCTAACCGCGATATGAGACGATTGATCGTTCCATTGCTCAAGAACCGCCACGATCTGAAGGTGCAAT
CCTATGTACGAACTCGTTACGTTCGGGTCTCGGACATAAAAATCACTTTGGATCATAAGCATAAGGACGAAGTAAGACTTGAAGCTTCAAGTGAGGACAC
TGCAAGCGACGATGGGGCCTCTGAAGGCTGCAATACAGTACACAAGTCCTCACTGTTGTGGGCCAAAGGCCACCTTTTCTACGGACCGAAGAGTGACGCC
TCCAGTACATCCGTGCTTCACGCTAGCAGAGTGCTGATCCCGTCCAAAGGTCGGTTCGCCTCTGAGCCTGTAGAACTTGGCTCTAGTATCACCGAATCGA
AGTCAATGCTGGAGGCACCTCGCAGAGCGTCGAAGTTGAGCCGAAAGCCGTCGCTTCCGTTCGATGCGTTTAATGCTCCTGGATCGAATTTAAGTAGCGG
TGGCGTATTTAGTCGATTACGCACGAAGACCGGAGTGGGAGCTATGCTTGGAGATGTCAAGACGCGACTTAATGCTCGTTACCACAAGAACCATGTCCAT
GAAAATGCTCTATGCGATGGCTGCGGTATGAGCCCCATTGTTGGTGGCAAATGGAAGTGTAACACTTGTGATAACTACGAGCTGTGCGACGGCTGCTATG
CTGCTGGAATCCACGGCTTCGAGGTCAACAACGAGTTGTGTCGTCGTGTGGAGCAGCTTGCAGTACAGAAGCATCGTTTGCTTGGCGAGTATCCAGAGCT
GCTTGAGCTCTTTCGTAACCATATCTGCCACGACCATGTCATCCACTTCAGGCGCGTTGTGGAATGGCTCTGCGCGATTGTGTCGGGTGCACGTTCGCAA
ACGATTTACCACAAGATGATCGTGAAAAGCGGACTCCATCCCGACATTCGGTCGCGTTTAGTGGCACAGCTTGGAGCACTAGCTAGCGAACGCACTGACA
TCTCTTTGAAGACGGAGTGGTTTGTAGAGATGACTCCGGAGGAAGAAGCTGCGGGATCGGACGACGCAGCGGTCGACTCGTCGCCTGTTGAGCTGGACGG
GGACAAACTGTCGCCGAGAGTTCGATTGGAGACACTGCGAATGTATCTGACGGATGCATCTGGCTTAAAGCAAAGCGATGAGCCTGGTGCCCCAGCTGCA
CTCTGCGATTTACTAGATCCGTCCGCCAATGTGGACGTCGATGGTACTGTAGCGCACTCCTCTCAACCACCGACATTGCGACGAACCGTCAGCGCTAGTG
AGGACGACCGAGTGGGCCAGTTGCCAGACATGCCACGGAAACAGTCGCTGGACTTGCCAATTTATGGCAGTCAGCGCGTTAAGTCGATCACGCAAATGAA
TATGTAAGACTGCATTTTGTTCATTTAGAAACGCGAAGAAATGCCACAAAATGACACTAAAATGACGAATGCTTTTCTTCTGCGATGATGCTTGGTTGTG
GCACGAAGAAATGCTGACACATGTGACGGGCCTTTGACTCGTCACATTTGCGCTAGGTAAGCGAACGTTGGCCTCATGCTTGCCGAGGAAAGCTTGCCTG
TCGCGAGGCTTCTTGCTCGAAGAATGCGTCACTTCAAGAGTCATGAATCATGCTTGGTCTTTGCAACGTCTGCTTGGACCCAGCTTCAAATCATCCGCTC
AGATCACAAGTTCCGCTTCGTTTTTCGTCACTTTGACACGAATGGAAAAGCAGTGCCGCGAGCACCGGCGACTGCCGCGCATGTCTGTTGCGCTCCTATA
AGTACTGTACATCGCATCTAAACCTGTTGCAACAAGCAGTGAGCCATGCCCTTCACGAGAAAAAAAAACAATAGAGGAAATGATACATTAATCGGCCTCA
TGCCTTCCTAGCTCCTATCTCGTTTTATTCCTCCGAGATGCAGAGCAACACCGCCAATGATATAAAGAGAGTGAACGCGCCACGAAGCGGCGTCGTCAAA
CCTTCACCGACACCAAGGAGACAGCTAGAACACCCAACGCGCCTAGAGGCTGGCCTTGCTGCACTCGGCCACAAACTCGCGCTGCGGCGTGGAGAGTCCC
CACACAGGTGCACCTCGAATGAGAAGACGCTGAATGAGCGTCCCTTCCTCGGTGGCGATCCGCGCAAGCGCCATCTTTTGCTCTTCAGCCGCGAGAGAGG
CCTTCTGCGCTTCCCATTGCTTCATGAGTTGCTGTAGCTTGGTCAGATCCTGCGGTTCTGCGCGCGCGCCAGGACTGAACTTTGAGCTGGCTTCGGAGCG
CGTCTTGGCCGAGCCATAGAAACCGCCCTGGCCTTCAGAGGGCTGGCCGCCCGAGTACGTGGTGAGCGAGCGCGTCGAGTTTACACGGCCGGTGGAGGCA
GCGCGGCGGCAGGTCTTAAGTACGGCGGATCGCATGGTCTTGTAGTGAATGTGTTGCTTGAAACGGTTTTTGCGTGTATACGTCGGCAAAAGCGGAAATG
GAAAGTGACCGCTGCAACTTGTGGCGCAAGATTCTCTGTCGATAGGATGGCGATGCACGCTCCCATAGCACCAGAATTTAGGAGAACCGGTCCTGGTTTT
GTGCATTTCTAAAATCTCGACCAATCACGGACGTCGACGCGCTGGGTGTAGACT