Description :
From Genome Similarity Track
Location :
Scaffold_140:131721- 139744
Sequence
8023 bases(100 bases per row)
TCCATACGACGCCGGCGTCCACAACGCGAACGTTCACCGCCCATCGGTCGATATCGAAGAGATGATTCACCTTGTGGATAGGTTAGAGCCACCACTGTTG
ACTCACAACCAGGTCTCGGACCTTGAGCGTCCAGCTGCTCGGCTGAACGTTCAGCTTGCCTTGCTCCTGCATCTCGAGCACTTCGCTCCGCGACCTGTGG
CTCTGCCACATGCTGTTGATCAGCCATCTGTGGATCCACCACTTGCTGTCGTTCAGCATCCCGTGGCTCTACCACCTGCTGCCCTGCAGCTGTCCGTGGC
CCAGCCACCGTTGGTGCCAACGCCTCCGCGCTCACCTGAGCAGGGTCTTGGTATGGCTTAAGCAAGCCGACATAGAAGACCGGATGCGTGCGCATCTTCT
TCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTGAACGGTCCTATGAACCGAGGTCTTAACTTCGTCTTGAAGACTGCAGACACTGC
ATGAGTAGGTAGGTTTTTAGCGTTTAATAAAACGTGGTCACCGACCTCAAACCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTCTGCGTG
TCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGAGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACAT
CAGCTAGCCGCTCGGCTATCCCTCCCCCACCAAGCCCTGAGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGGTTAACCAAGCCGTTCACATAGAACG
GAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCAAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCG
GAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCAAGCACTCTGAAG
AGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCTGAGACAATTGCCTCAGGCAAGCCATATTGGCGAAAGACTCTCTCAAAAATCAGCAAAG
CTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAGGTGAGCCATCTTGCTCAATCGGTCTACAAAGACCACAATACCCGTGTTTCCTGCCTTGTC
CTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTC
GTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATTTTGGGCCACCAGTACATCGTGCTCACCGAGCCATAGGTCTTCTCCC
GACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTGAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGC
GTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCTTTGTCAGAGTCTAGAAACTCTTCG
CTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGGGCTA
ACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCA
TCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAGCGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACC
CTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCGCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCA
CGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCAAAGACGACGCTAAGCGGACTATCCGGGTCCGGTAG
CGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGATGCGTCCTTCTTAAGAAGATCT
GATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGGAAGTCCTTTTAGTTCTTGGGAACCG
GCCAGTCCACGATGGCCTTGGCTTTGGCAGGATCTGCCTTTAAGCCTCGCTTCTCAATGAAGCACCCGAGGAAAGGTATTTCCTTCGCGCCAAAGACGCA
CTTGTCCAAGTTGGCATACAACTTATGCACTCGAGCACCACTCGCAAGTGGTCAATGTGGTTTTCCACGTCTGACTTTCCGTGCTAAGCACGACTATGGA
CGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTCACAAGACAATTGAACGTTGCTGGTGCGTTCGACAGCCCCTG
GGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACC
AAGTCAAGTGCGCTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTCAGCT
TGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTC
GTGCTTCGCACGAAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATC
TCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTCGAGACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGAT
CTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTCTAGGATCGCGTCCACGACGGATGAGGAGTTCAACTCCTCCTCATGTCC
CAGCAAGACCACCTCGGCTAGCTCGTCTGCCTTTAAGGCTTCGCCAAACTCGGCAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGA
GTATCAAGGCTGATATCGCCTTCTACCTCCCCCGTCACTCCGTTCACGAGTGTATACAGCTGTTCACAGCAATCACGTGGAGCATCACCGCTCGTCACGT
TGGACACATCGTCCGACGTCGAAGACGTCACAGACGCCCTGCGTCTTCTTCTCCTCTCCCTCCGCGACCGAGCCCGGCCGGATGAGGGCGGTGTGGCGAC
ATCTCCGTCACCACCACCGGGTGCAGCAGCACCATCACTCCTCGAAGAGGATACAGTGTCTCGCAAGACACTCGGCTGAAAGCCAAGAGGTTTTTGACCT
TCACACAGTGAACTAGGTGTCAGTTCACCTGCATCGCCTGGGCCACGCCCATGATGCCTCGACTCGCAGTCGACCGCGACCCTCGGGTCACGCAGCGGTA
GATCATCGACCCGATTCGTACCACTCAGTGGATTACGTGCCACTCCGCGCTCGTCCTCACCAGGACCCAGCAGTTGGTCATTGACCTGACCTGCACCGCT
CAGCGGATAGCGTGCCGCACCACGTACGCCCTCAGGGCAAACAGCAACCTCGTTGCTAACAATTTCGGACATACCAATGTCCAGCACTAGGGCCGCCTCG
GCCTCGTGCTCGCGCCAAAAGCGCTTCTGCTTTTAGCAGAGGTGGGTTCATGACTCACCAAAGGTCCACTAGGAGCAATGTGCGACGCACCTAGCGTTTT
CGACTTTCAGTCGATCCATGGCTCATGACGTTCCAGTCATGCCATGCCAAGGATGAGGTCATACCTCGCATCCAGGTCTAAGACCAAACAGCGTTCCACG
CTATCGAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTCCCCGTCGCGAGACGGACAGAGATCGTATCTCTCGTTG
GCACTTCCAGTGCCTCAGCATACAGCTGACTCCCTTCCAGGGTGGAGCGACGGGCGTAATTGCCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTT
TGCAAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCCCGGCTTGCACACACTCTTCTCGTAAGAGAGCTCAGCTCTCTTCGGGGCTGAGCCCCGTTGT
CCTCTACCTCTTCGAGGCACAACAGAACTCAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGGGAATTGCCGTTTCCCGGCGATGACCCGGAGGGTTT
GGCTCGCCGGAGCCTCGCGCTTCTTGCGCAGAGGGAAATATGCCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATCGGCGGATGCGGGCACGCTGCTC
CGCATCAAGAAGCTCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGGCTCTGGACCGCTCGAAGAGCTTGCGCTACTAGCGCTCCAACCAGGTCAA
GCTGACCTGAAGTTGTGCTCGGCATTTAATGCCACATTCACCGCCTCTTCGAAAGAGTTAGGGTGTACACGGAGCACTTCCGTTCGAGCTGCGCTCACAC
GAAGTCCCTCCATGAACACGGTCACGCTGACCAGTTCCGGAAGAGGGTCCGCCGCCATTCCGGCGATAAGAGTTCTCAACTCTTGGACATAGTCCAATAA
CTCCTTCTTACCCTGGCGGGTAGCAAGGAACTTCGACCGGATACAGTACGCCTGATTAGGCGGCGCGGACACGCGCGAAAGCTGTTGCTTCAGCTGATTT
CAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCCATTCGCGAGCGCGACCTCCAAGCCTGGAGATAGCCAGCGCCACGCGCTGATGCT
CAGACTGGAGCAGGGCCGATCCCATGGCCATCTCAACCTCACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCTCACCAT
GAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCCGTTGCGGCGCTCATCTTCTCTTGGACATGCTCCAAGAGCGCGTTCTCGTAG
TGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGATGCAAGATGAGCCACGCCCTCCGGGCCAAGCAAGGACATAAGCTTAGTAAGCG
CGTCCTGCTGCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCAGAGGATATAGTCAACCGACTCAGGAGCGGGATTGACTACAAAGTGCA
GCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATATTAAGTTCCTTATCTAAAGGACACTTACAGCCCAAGACCAG
GGCTCAAAGTTAATACCTTAACTTTATGCTTCAAAACCAGAAGTGTTTTATTTACCATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTCTTTAAC
TATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCAGCCAACGTACTGAGAGACCTTGTTAACTCTCCAACTTATGTACTGAGAGTTTG
TTAATTCTCCGGGTACTTCATACCCCTGTGGTTCCACACCATGTAACCCCGTTACAGTAGTGGACATCTCTGGTCAAGTAGGGGTGGAGATGCCCTCGTA
CGAGTACGGGTACGAGTACGAGTACTCGGCGCCTGCGGAACGCTACTCTTGTCCGAGTGCTTCTCCTGTGGGTCCGACGCAAGGCCCTGCGGTTGACCGC
CTTCGTCAACGCGTCCTCGTGCTTGAGAGTGCACTTGGCCTTGGGACTAGCGGTGATGCTGCGCGTGCTCGCTCGTCATGCGGGCCGCCTAGACCTAAGC
CTGTATCTGCAGGTGGACCGACAGGTCTCTTCGTCTGATCTAGACGAGGCCTTCCCCATGGCCCGACATAGCGAGGCTCTGCTGCCACGTCCGGGGCTGC
ATTCGGCGCACTCCCAGTCGCTTGCGTATGGTGCGTACCCGACGTACTCGACCAGGTGCTCGGCGTAAAGCCCCAGGGTCTGTTCGTACGGTGCCCCTCC
GGTGTACGGTCATGACCGCAGCCTTGCAGTTCAGCCCAAGGATTGCGTGCCTGTTCCGACGCCCTCGTCGACGTCTGTGGTCGGCCCTCGCTTCGAGGGT
TGGGCCAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGATCATGATGCCGCTTAAGACGTCCAACGTAGAACGTCGGGTGCGTCATCATTGCGTTGGGC
AGGTCAATGGGGCACGACGCACCATGCCTGGTCAGGACTGCGAGCGGTCCAATGAAGCGGTGCTTCGGCTTGGTGTTGCCGATAGAGCATACGGTGTCTA
GTGGTAGATTTCTCGTGTCTAATAACACTAATTCACCCACCTTAAACACACTCAATTTTCCTCGTCCATGTTTGTTTGCGTACTCCTTCTCTCTGTCTTG
GGCCGCTGCCATGGCATCACGGGCTCTGCCGATCACGCTCAGTTTTGGTATCCACAAAGGATTCTACTTGTTTCCGCAGCGAAACCTGTCTCACATCTGA
GACTTGGGACGAAAGGGCTTTCTAAGCCTCTCCCCCACTTAGAATAGAGTGTCTCCTCATAAGAGTTAGAGGCACTCTGGGGTGATAGAAGCCATTCAAG
TAGAGCGGCGTGAGCCCCGTGGACGCGTGCACAGCTTTAGTTGTGTGCAAAATCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTTCCGCGCAC
ACACTGCGCAGACTGTCTTCGAGCACTCGATTGACGCGTTCTGTCTGGCCGTCTTTCTGTGGATGGTCCGCATTGGACATCTGCAGACGGATTCTAAGTA
AAGGCAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAA
CAACCTTGCGGTTTGTTCGCCTGTGACGGTGACGGGTACTGGGGCAAGATGTACCATCTTGCTCAGCCGACACACGAGCACCAAAATCCCGGTGTTGCCG
TGTCCGTCGGCGGGAAGCCCAAAGATAAAGTCAAGACTCATCGACTTCCAGCAGTCAGCCGGAACCAGTCTCTGTAGTGGAGACGAAGCGTGGCCTGCGA
GTTTGACCCGCTGAACATGTTTCACATGTCTTCACGTAATCCGGCGACCCACATGTACATGTGGGTCCAACAGAAGGCCTGAGAGACCGACAGGAAGGTC
TTCTCGCGACCCAAGTGGCCGCTGGAGGGTGCGTCATGTGCCTTCCTGAGGATGTCGAACTTCTGATCCTCGTCGTTGAATACGACCACTCTTGAAGGTT
CCTTGGGCTCCACCGGTAATAGAGGAGGCCATCCTTCAACTCATATCGGTGGATCGGGGAGCGCTGTCGCGACGAAAGCCAGTCGGACTTCGCGTTCGTT
CCTGGTGCGAGGGAGTTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCACGCGTATCCGATTATATAGATCCGTTGTCACCCGCGTGATGTGG
GCCAACGCGTAGTCAGGACACCGCGAGATGGCGCCCGCGAGCACGTTGAGCTTGCCCTGCTTTTACTCGACGCGGAAATTGTACCCCGCGAAGAAGGACA
GCCAACTCGCCATCCGTTGGGAAAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGAACACGAAGGGCCTCGAGCCCAGAAGGTG
AACACGAAACTTCACAAGGGCAT