Description :
From Genome Similarity Track
Location :
Scaffold_16:1317102- 1325126
Sequence
8024 bases(100 bases per row)
CCATGTCGACTGCCCCGAGGACCGTGCGCGCGTACGCCACATTCGCCACGGGCGAGGAGGCCAAGCCATGGGAGTACCAGTCGCGTCCTCTTGGCCCTGA
GGACGTGGAGATCAAGATCTCGCACTGTGGCATCCGTGGCTCCGATCTACACACCATGGACAGCGGCTGAAGTCAGACCATGTATCCGTGTGTGGTCGGC
CATGAGATCGTCGGTGAACCGGCGACCAAGTGAAGAACATGAAGGTGGGTGACCGTGTGGGTATCGGTGCGCAAGTGTGGGCCTGCCTCAACAAGTTCCC
GGACGATCCGTGCAAGGAATGCGCCAACGGCAAGGACGCCTACTGCCGCCACCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGACCAGCTGCGACTGCAGCGATATTCGATATCAGCGATGTGTGGCTTTCAAAAAATATTA
CCGCCAGTTATTCTTGGGGTTTGTTGACATGGCGATTGTCAACGGGTTCATCCTGTACAAACTCATCTTGAAGAAAAAGGGAGAACGCATACCGACGCAC
GCAGAGTACATGCGAAGACTGCAAACGGAGCTTTTAGCAACAACAGAAGCCACATTGCGTGCAAACACCAACGCAGAGGATTTGATTACGGAGCCAATTC
GAACGCAGCCACACGCCCTGCAGAATACGAACGACATGTATGATGAAAATGGGAAGAACAAACGTCGTCAGCACCTTTGCAAGGTATGCTCGGCAATGGC
GACGCCCCAAACGAAAAGCTTTGAAAGCAGCTACTTCTGCCCCCAGTGCACTCAATCCCACGCCGGCTACGTACCTCTATGTAATCGCGTTCGGAGAGAG
GATAGCGGCAACACGCTCACGTGCAGCCAGATTTGGCACCAGGTCTGGCGAAACGGAACTGCGATTCCAGCACACCTGAAGAAGCGCATACGCTTTCGCA
AGCGTAAGCGCGCTGACGAAGAGAAAGAAGACAGTAGTTAGCTAGCTAGTAGTCAAATCAATAGACTGTTCGCTCACCAAACTTTTCGGCCAGTTCAAGC
CTAGTTCTTCTTCTACTCTTTCTAGTCTAGAGCTGGCCGAAAATTTGGTGAGCGAACTTCTGCCGCGTAGCGATGAAGCTCTGGCGGCCATCCAAAATGG
CGCAAAGCCGCCAATCTCACTTATCGTTTTGGAGGGGAAATACCTTACAGAAGACATTGCGATCTTTTTTTATTCTGCAGTAGCCAATCAAAACCCCAGA
TAATAGCGTATGGTGCATACATTGCGAAGTTTTTGTCCGTAGAAACGATGTCTTTGCACTTTTTCGCAGTGTCCACCTCACAGGATTCGCGAGACAGCTA
CCATTAGATAAATTGTAGCATTCTTCTGTCAATAGTTTAATCAAGATAAACCTTTTATTCTATATAATACAGAATAAAACCCCGCTTTAAAGGGTTAATA
GTGCCGCCCGAAAGTGACAGAGAGGACTTTAAACGGGTGAGGGCTTTATTCCTTGCTGAAATGACTCGTGTACCAGGTTAATATCGTCTAACGCATCATC
TAACTCTGAAAGATTTAACAGATCGACTTCGTTCATATGCGGTTCCTTCGACCACTTTTCACGAAATTTTGCGCCTTAAACATCGTGCTTGGATATAAAC
CACGACGAGGGGTTTCTCGAGAAGCCTGCCATTTCAACGCTCCGCATGATTGTTGCCTCATCCGTGTCTCGCCACGCGCGGAGGCCCCAATCGCAAACGG
CGTCAAGACTTGTCATACGCGGGTTATTAAAGCGAGTGTATTCGACTCGGTCTGGCTCTTTCCAAGCGTTAATTTCCATGTACAGTAGGTCCTTGAAACG
ACATCTTTAATCCACTTGATCACCTCTTGCTTTCTCCCAATGCTAACTGACTGCCTTCGATGAGGCATTATTGGAAATGACGGGAAAGTGTTTCTCTCTG
TAGAATGGATGGTCAATAGCAGATTTGGTAGTTTTTATAAGGACTCTATTCAGGAGGGGCTTGTATTTAATAGTGCAGGCATGTAGCACCCCACAGGACA
CTATTCGGTAGGGGGCTTTTATTCGAGCGCATCCGTTAGTATCCATAGTGGAATGCCATCGATAATTATAATAGGGCGTCGAGCTTCGATGATCCATTAA
GCGCAAGAGACGATTTAACGTTACGTTCTGCGATTGCGGGCGATGCGATGCGAGGATTTGACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCGGC
GAAACGTCTCAGTGTAGTCGATGCCGTACTTCTGCACAAATCCTTTCGCGACGAGTCGAGCCTTGTATTTCTCGATGGATCCGTCGGCTTTACGCTTGAT
CTTGAACACCCACTTGGTTCCGACCGCACGCTGGTTGTTCGGTAACTTGGCGCCATGAAACACTCCACGAAGTCGCATCGACTTGAGCTCTGCTCGGATC
GCCTTGCCCCAGTAGACTTGGTCTTCGCCGCTCACAGCCTCTTGGAACGTCTTCGGCTCGGCGCTGTCACTCGTTTCCACTGCATTCGCACTCGCACGCC
AATACATGGGATGAGTCGAGTCATCATCATCATTGTCTTCATTCTTGGATTCTTGATGGTCGGAGTCATGGCCCGGAGCACTTGCTTCTTCCAATCCAGC
ACTGCGACGCGGTCGACGAACTTGTTCTCGTTCGTCAGGGTTGGAGCGAGCTTTGCGTTTTCCCGCCTGCTTGAATTCACGAGTTCCATGGTCGTCCGAA
ATCTCGAGGTCGTCCAGGATATCCGCCGCATCATCGACTTCTTCATCGTCATCTTGAACATTGACTTCGTCAAAGGTGGATTCGTCGAAAGTGACATCGC
GAGAAATCACCACCTGCCCCGCCTCGATGTCATAAACGCGATACGCCTTCGAACGCTCTTCATAGCCCATGAAAATGCCTTCACGAGCCTTGGGGTCCCA
CTTGAGTCGCTTCTCCTTCGGCGTCAGGACGTAGGCCTTGCACCCGAAAACGCGCATGTGCTTCACGTTGGGCTTCCTCTTGTACACAATCTCGTAAGGC
GTCTTCCCTGGGACCTTGGGTGACGGCAACCGGTTCTTGATGTAGATCGCCGTCATCGCCGCTTCCGCCCAGAACGTCTTGTCCAAACGTGCGAAGTGAA
GCATGCTGCGCACGATAGTCACAATGGTCCGGTTGGCGCGTTCCGCAGTCGCATTGGTCTGATGCGCATATCGAACCGTCGGTTGGACTTCGATGCCATG
GTCGTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCCTTGGCACCGTCATGACGCACGAACTTGACCCTGGCATCGAACTGGCGCTCCACCTTGGCG
ATAAACTTGCGCAGACAGCCTTCACTCTCCGACTTGGCGCGCAAACAGAATCCCGTCATGCAGCCGCTGGCTTCGTCCGTGATCAGCAGCAGATACTTGC
TGCCACCAAGCGACTCTTTTTCCATGGCGCCACAAAGGTCGAAGTGCAGGAACTCGAGATGCTTGTACTTGGGCTTGTCCAGGTTGCTTGGAAATGGTTT
TTGGACCATCTTCCCTTGCTGGCATCCGCGACATCCGCTCGAGTTCTTCGACGAAGTCGGCATTTTCGCGCCCGTCACCATGCCGCTCGAAACCATTTTC
CGCAATACGTCGTTCGGAGCGTGACCCATCCGCGCATGAAGATCGACACCGTTGATCGAGACCTTGGACGTCGAATTGGCAGACACCTTGGGCACTCGCA
GCCAGTAGAGTCCGTCGATCAGGTCCGCTGAGGCAACGATCTTCTTCGACGACTTGCGCGCAATGTGCATCTCGGAGCCGTCAAACACCACCTTGAAGTG
TCCGCCTCGGTTGATCTGAGGCACAGACAGCAGGTTCTTGTTCATGCTCGGCACGTAGAGAGCATCTTCGATCCGGACGTTACGCACATTCCCATTAGGC
AGAACCACTTGTTGCACAACGGTGCCGATTTCCAAAATCTTGGCCGTTTGTCCGTTGGCAACCGTGAGTACGCCTTCGTCGCGCAAGTTGATGTCCACAA
ACTTGGACTTGTCGTTGCAGATGTGGTGGGTTGCACCACTGTCGATCGCCCATGTGCCGTCGAACTTCTTGCCCGTCGATACTCCACACGCTGTCGACAT
GGAGACCGCAAACGCGACGTAGTCGTAGTCGTCGTCGTTACGCCAGTCGATATTGTTGGCACCGCGGCCACCTCGACCGCGTCGTGCACCTCCTCGGTTT
TCATCCTTCTGCTTGGTCCAGCACTTGTCAATAACGTGCCCCAGTTTTCCGCAGTAATCACACCGGCGAGTTTCACGCTCGGCGTTGAAGGCCTTCGCTG
CTTCCTCGATCTTCACCGCCGCAGTCTTCTCGCCTTGTCGCTTGATATGCTCATTCGTGAGCACCTTCACCACATCTTGCGTTCGCAGCTCTGCATTGCT
CATCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTGGGTAGACTGCGCAGCAAGCAGATCGCCACATCCTCGTCCTCCATCTTGGCGCCGATACTGCTG
AGCTTGGCGCTGATGTTGAGGACCTCGTTGCAATGGTGAAGGATGTTTCCGCCTTCTGCCATCTCCATGCTGAAGAGCTGGCGCTTGAGGTAGATGCGTC
CAGCCTTCTGCGATCCACCGTAAAGGGTACGCAAGCGCGCCCACGCGACCCAGGCTTCCTCGTAGTCGTCGACAACATGATGGTAGTCCGCGTCCATGTG
GAGGAGCATGGGACCGAAGGCGACGTTGCTCGACTTGACATACTCGTCCTTGGCCCTGGAGTCCGTGAACGTGGGCGTCGTCTCGCGGTTCACCACATTC
CACACCGACTTGGTCAGGAGCACGCCACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAATCATTTGGTGCATCCAA
TCACCAACCCTCTGTACTCGTCCAATCATCCTACTCGTCTAAGTATCAGTGGCGTAAACATCCTACCGTAATCATCGCGGGATCGTATTGGATTACCTGC
AACAATGGTCATTGTCGATACGTCTTGCCAACCTTGTGAGCACCACTTCATCGCTGTATAAATATTGACGGGGGTATACGTCTCGCCTTTGTAAAACAGA
GACAGTGTCCATGATGGCTCTGTGGCTGCCTTCCTGCACAATGTTTGCTCATTGGCGAGATTCAACGTAGAATAGGCGGGCGGGCGACGTGCAATGGCTT
TTTGCGACAAAATTTATAATGAGCTGTTGTATGGTGAAGTGATTGAGCTGATACATCGTGGCGGAAGTGCGGCGTTTCATCCCTCCTTGAGGTTATTTGG
TCCAAAGGAGATGGGCAACTCATTTGCGCAATGCATGTGGCCCAATCATTAGATTGTGCAGGTTATTAAGCCATACCGGGGCCGAAAACGAGGTGCACGA
CTGTACTTGTTTTTATATTAAAATTGTATATTATTTTATATGTATCATTTTTACATAGAAACAGTAAATACAGCAGCACTTACAGTAGACCTGTTTTGAG
AATACGACTCTATTGGCTAAGTTG