Description :
From Genome Similarity Track
Location :
Scaffold_39:13171- 14509
Transcript NameFunction/comments
Sapdi_VS20SDRG_11074hypothetical protein

Sequence
1338 bases(100 bases per row)
CCCTTGTCAGTGCCGTCCCTGCGCTCGCCAAGCAGCCGTTGCGATACGCGTCAACACATGTTGCCTCGAGTAGACAGCGCGCCAATCACAGCATTTTGAG
CGACCGACGCACCCGGAAGGTGGGATCCAGATACGTGGGACTGATTGAACACTAATGCAAGCATCGCATGGCGTCTTCGCCTGCGCTCACTTTCGGATGC
TCAAATCGCCTCTCTGGCGGCCGCTTCCGACAAATCTACATTGAGCTGCAAAGAAGGACCGGATGACCGCTGGCATTGGATGTACCTACCCCGAAGAACA
TGGCGCGCACGACCGTGCATCCTAGGTTCAACGCCACGCGCGTGGTGCAAAGACGCTCTCCAAACGAGGTTGTCTGCACTTGGCGTGGCCCATGTGGCAC
CAACCATCTAGATAGCGTCCGCAACCACACGTCCACAGAGACGCTGCTGGTTCACACCATCCGTCCTGGTCGATCGACAGGTATATATAAACTCGCAGTA
GTTATGATGTTGCGGAATAATCCGTGCCTCTTTTGGTCTTGTGTGTGGAAAGCACCTTGTACGAGATCGTCTGGAGAGACCAAGTGGTCGCGCGACATGC
CGCACGCTCCAGAGGTGTAACACGCCGATCGTAACAAACCCCAAGTTATATAACACACTCCACGACGTTGCCGACGCAACTGCTACTGCGCCGACGGAAC
TCGGGTCATTTGCTCTTTTGCACAGCACGACCTACCACAATGCTTGCCGACATGTTCGACCCGATCCCATACGCGACGACGACGGCGCTCAAGACCGAGG
CGTTCGATACGTACGAGCTCGACGAGCTCATCCAGCACACGAGCTTCATCGACGACGCCCAGGCCTACTATCCGTCGTACCCGCACCACTACATGCAAGC
TGCGTATACGCCTTTCCAAGCCATCAGCTACCAGTGCTTGCCCGTCCCGCTCACCCGCACGACGACCGAAATGAGCGATTCGAGCGCGTGCACCGACCAC
GACCAGTACTGCCCACCGCGAAAGCTCTGCGCCATCTTTGGCTGCCACCGCAACGTGCGCTCCAAGGGCTTTTGCAAGCGCCACGGCGGCGGCAAGCAGT
GCTGCATGCACGGCTGCGTCAAGGAAGCCCAGAACGGCAACTACTGCATCGGCCACGGCGGTGGCAAGTGCTGCAAGATCGACGGCTGCTCCAACGCCGC
GCAGTCCCAAGGTCTCTGCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN