Description :
From Genome Similarity Track
Location :
Scaffold_398:13169- 18359
Sequence
5190 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGTCGTGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCACGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTCGATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCGACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGT
ATCCGGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGAGATGAGAACTCTTATCGCCGGAATGGCGGGGGACCCTC
TTCCGGAACTGGTCAGCGTGACGGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAGCGGAAGTGTTACGTGTACACCCTAACTCTTTTGAAGAGGC
GGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGCCGGCGCGACCTGGCTGGAGCGCTGGTAGCGCAAGCACTTCGAGCGGTCCAGAGCCGATGGAC
CTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGG
CCTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCTAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCTTACT
GGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGGGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGC
CGGGCTTGCTGGTCGTTCAAGCGAGCGTAAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCAC
CCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAGCGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAGCTGTGTCGAAG
GTCTCTGTCGACCTTGGAGTCTAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGG
CATGGCTAGAACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCAC
CTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCT
GTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCGACGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAG
TGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGG
CCCAGAAGATGCAGGTGAAGTGACACCTAGCTCACTGTGTGAAGGTCGAGGACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGATACTGTATCCTTTTCA
AGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCACCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGAC
GCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGAGGCTCCACGTGATTGCTGTGAACAGCTGTACACACTCGTGAA
CGGAGTGACGGGGGAGGTAGAAGGAGACATCAGCCTCGACACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGTCGAGTTTGGC
GAAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCAGTCCTAGAGGACA
CCAAGAAGGCGCTGAGTGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTTGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAA
AGACCCACCAACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTAACGTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAGTGGCCTTTGCCG
AGAGAGCAGTGTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGAAGGTGCGCGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGC
CGAACGGCAAGTGGCGCATTGCTCATTCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAT
CATGGTAGGATGTACGTTGTACAGTGCGCTCGACTTGATCGATGGTTACAACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACT
CCGAGTGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGCGACGCAGTTGTTTAGGCCCCACC
GGGCGTACGCTCAGACGTACTTTGACGATATATTCGTCCATAGTCGTGCCAAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGT
GCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGT
GGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAATGGCTAGGCTTAGCCAATTACT
TGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGTCATTATCAGATCTCCTTAAGAAGGATGCACCATGGTGCTGGAACGTCGAGCACGACGGAGC
CGTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCCCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCA
ATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGGTCAAAGCGGCAGAGAAGAACTATCTAGTTC
ATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTAAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGGTCTTTACTGATCATGCGTCGTT
ACGCACTGTGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGATTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGG
CTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGT
ATGCACAAGACGACAGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCGGGGCGCTTACGCGCGAGGCTG
CATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAA
TCCTCTACGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGGGCTCGATGTACTGGTGGCCCAAGATGTATAA
GTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGA
TGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCGGAGAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGG
CTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGT
CTCGGATCGAGACCCGCCCTTCACCGCAAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCTACAGCGGACCATCCGCAGACC
GATGGTCAGACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACATTAAA
TAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAGCGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTT
GATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTCTTTAAGACTGAGCGTAATGCGTC
AAGTACGCGACGCTATGGCTGAAAGCCATGACACGCAAAAGGAACATGCAAATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGAGACCAAGT
TTTATTAAACGCTAAAAACTTACCTACTCATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACCGTTTAAGGTCGTGGCCAGG
AAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGCCTTCTATGTTGGCTTGCTTAAGCCATATCAAGACCCT