Description :
From Genome Similarity Track
Location :
Scaffold_159:131682- 137891
Sequence
6209 bases(100 bases per row)
GGAAGGACCCAAAGCTGGGTGATAGGGCAATTGAGTGCAAGCTTTTGGGACTTTTACCAAAATACAAAGGGTACCGTCTTCTTGATGTGAAGGCGAACAA
GTATCTTATAGCGAGAGATGTGAAGTTTAGTTTGACTGGTACAGAGGCTATGATCAGACGCTCGTTTCCCAATGAGGACTCCAGCATTGATCACGAAGAG
GTACATGCTATCGGTCAGTTAGGCAAACAACTAAGAGGCACAGTTGCAGGTGATGTGCCGGCTGACGAAAGCTCAGAACCGGTCACTGACCCACCGACAT
CCCGACTAGTGGGAGATAAGCGACAGGCTACCAGTGACGTCCGTCGATCAAAACGGCAGCGAACACGCAACGTAAGGCTTAGTGACTACGTGACCCAGCT
AAATCTTGTAGCGTCAGATAAGCCGGACAGAATCCCTGTTCCAAAATCGATTAAAGAAGCGCGACTAAGTCCTTACGCTTAACAGTGGGAGTCTGCAATC
AAGGCAAAATATGATGCCCTTTTAAGTAATAATACATGGGAACTTGTATCATTACCTAATGGACGCAGAGCCCTTGGGTGCCACTGGCTGTTTGATGTCA
AGTACCATTCAGATGGGTCTGTTGACCGCTTTAACCCCTTAGTTCCCGTATGTTTAGCCGCTAAACATAAGAGGTGTATAGCTTCTTTCAGTTTTTTTCG
GCATCTATGTTATGTTTAGCGGCTAAACATAAGAGAAAAACTGACTTGGGGTTTGTATTGAACAGATCTCAAGAGAGCGCACGAAGGCAAGTCACCTTGA
AGCGGTGACCCCAGTGCAATGTCGCTGGGATGCTGATCTCCACACCTGCAACATTGTGCATCATAGGAACCTTATTGACACGCAATGTTTGCCCCGAACG
CGACAAAACACCGCAAGAAACGTTGATGTTGATCAACGCTTAGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACGGCCGGATGCACAGGCTTAGGGTAGCTGGACCGGATTCCTGATTGAACG
AGATAAAGAGAGGCGGTGTCACCCACCACCAACGGGTGGCCGACAGCCACAAAACTCTCTCATTCTTCAAAACGACCGCGGGGGCAGCAGACCAGAATGG
TGGCGACGTCTGGCAAGATGCCACGACGGACGCTGACAGCGGAAGAGACCCGGTTGTGCAAGGCAGCCCTCAGTGACCGCCACAAGCGTCGCCTTCGTCG
AGACGACGAGAGGCAGTCAGCAGCAGAGCCAAAGCATGGCGCTGAGGGGCGTGCGTTGAAGAAGCAGTCTAGGAAGAGGGCGATGAAACTTACGACGACA
GCCATGGAGATAGCAGAGTCTAGAGGTCCACATATTGAGCCGGCAGCACCCAAAGAGACAGAAGCAACAGCGAGTACGGACGAAGCTAAAGAGGTAATAC
CTGTTGCAGAAAATGAGGAAGATTCTGTGGAACCAGAGGTGGAGGAAGTTGTAGCAGACGTGGTGATGGCTGTGGCTTCAGCTGTGGCTTCAAGTGCGCT
TCTAACGCCTGTATGAGATGCTCAAGGCGCTGTGGAGACCTTGCGCCCCCCTCGGACGAACAAGCAGGCGCCGGTTACGCAAAGATCCCCGAAACGACGC
CGCCGCGTCCTACAAGACAGTCCAGAACGCGAAGCTCAAGCTGAAGGCACCATAAGTGACACCACAGACACCGGTGCTGCGTCAGCTGCCCCGCATCTCC
CTGTCGCCTGCGTAGTCGACGGTGATCCTAACATCATGGCGGCTGGTGCACGTGAGTGCACTGGCCTCGGATCAGAAGAGGAATCTGGGCCTGATTCAGA
CGATGACGACGCGGACAGTGAGTGGGAAGGAGATTGGGAGCTTGGAGAACTCTCTGATGAGGAGTTAGCCGATTGCGTTGGAACTGAGCTACCGGACACG
TTCTGCAAGTCGGTGGCGATGAATGCGGCGCGTTTGGCGGAGATGAAACATTCTGGCTGGGAGTATGGTAAGTTATGTTGAACGCTATCCAACATACGCA
ACTATTATTCCGTCGTTGTCCAACATAATGTTAACATTATCTAACTCACTTTGATGTGCTATTTGTAGACCAGTCCAAATTTGGAGACAATCCTACGTAT
GAAGACCCTACGACGGGCCTTATGGACCATCTGAGAGCGTCCTTGGAGTGGCTGAAGACCCACTGGCGCTGTTCTTCTACTACCTACCGCCAAAATTGTG
GAGACAGATTGCCGTCGAGAGCAATCGCTACCACACGCAGTCGATACCGGGTCGTGCGCAGGCGATTCAAGCGAAGCAGCGTCGTGGTGGTGGAGAAGTA
GAGAACCTCGCAGATATTCGTCGGCGACTAGCACGTGTGAAGCCGATAGAACCGTGGGAGGTTTTGCGCGTCATCGCGCTTCTCATTGCAAGGATTCTGT
CTCCAGTGCGAAAGGGGATTGCTGCTCACTGGGAGTTGACACCGGCTGGTGCGTTGCCAACGCCACGCTTCGGCAAGTACATGTCCCGCAACCGGTTCTT
CCACATAATGGGATACTTGCACTTCTCCAACAACAAGTCGCCTCAAGCTAGCACGGATCGTGTATGGAAGATTCGGCCGGTTATCGAGGTTTTACAGCGT
ACATTTGCGCGCGGCTACAAGATTCCTCCTGTCATTAGCTTTGACGAAGCTACGCTGCCTTCAAGATCCCGCTACAATCCTACCAGACAGTTCAACAAGG
ACAAACCGCACAAGTGGGGGACCAAGGTGTTCGTGGCAGCGTGTGCAGATACAGCTTATTGCATGAGGTGCGTTCAAGGTGGCAAGCTAATGCTTGCCAC
TTTTTGTTTTGGTCTAAGTGCTTATGTTGGACGGGCAAACATCCACATTGTGGAGAATTTCCTAATCCAACATATTTATTACTTTTACTAATATCGTGTG
CGTTTGTGCGACTGTTCAGATTCGAGGTGTACTGTGGTGCTAAGAGTAATCTCCGGACTCCGATTCCTGCTGATAATAATTGCGGCGAGGCTGCCGTACT
AAGGAACATGAACGCGCTGTGCCCGCCATCACCGACCTCCCCGTGGCGTTTGGTAATCACAGACCGGTTTTACACGTCGGTGAAGATGGCGTTGGAGCTG
TTGCAGCGACGGATGTACATTACGGGTACGATCCAGACGCGTATGGCAGGGTACGCGAAGGATGTGAAGACTGACAAGTCTTACAGAACCGTGAATGGTG
TGAGAGAGCTAGTACCACCACAGGTGACAATCAAGCTGGCTGAAAATAAGCTTTTTCCGCAGATAACCGCAGCAATGTGGATGGACCGCAATCCCGTCCA
CATGCTGAGCAGTGGTGGCAGCAGAGAAACAGTCAGTGTCAGTAAGTAAGCCTGTGTGTTTATATATATGTATCATTGCTCACTATTGTGCTTTTTTATT
GTAGTGCGGCGTATCAAAGGCCAGATGAAAGAGCTACCGGCACCGGAGCTGGTTCGTGACTATCACCGATACATGGGAGGTGTTGATGTGCACGACCAGC
TCCGGATGCAACGCTACAGCGTGCAGCTTTCGTACAAATCACGAAAGTACTACAAGACCTTGTTTCTCGGATTGCTGGACATGGCGTTGGTGAACGCCTT
TATTGTGTATCGACACAACCAGCGTGCCAATGGGCACAAATCCCCGAAGCATTCCGCATTCTTCGAGACACTCATGGAACAACTACTTGCTGTTGATGAA
AACTCTTTCGCTGAGACTGAGGTAAGTTGCTATGATGGGTTTGGCAACATAAATGCATTTACTAATATGTGTTATGTTGGTTATGTTTCCTATTCTAGAA
ATCCACCTCCGCTGAGGAGCGTACAGCCGCTTCACCTGCACGAGGAGCGTCGCCAAGACGGGAGGAGCAGCGACGTGGCTCAGACCGCATTGATGATGGC
CACGAACTGGCGGAGAACCCAGACAAGGCCGACACTGAAACCGGAAAGAAGCGTCGCCACAGAACCTGCAAAGTGTGTGCTATCTGCAAGGTGGTGCCGC
GGAAGTATACGAAGTATTACTGTCCAGAATGCTCTGCAGGGCCAAAGAGGTACGTACATGCTGTTCATGCTTGATACTAACACGGTGATAGCGCTGACTG
TAGGTTGTGCCGCAGGAAGTATCTCTGCAACGTTGTTAGGGAGATAAGGGAGCGCACGTGCTTTCAGATATGGCACCTCGACTGGAAGAACGGGAATGAC
ATCCCGAGCCGCTTGCTACGCGACCACAAGATACGCGACCGAGCGCCAGCGGAGCGTCCAGGCAAGAAGCGGAGACGCAGACAGCAGGTAGGCGAGAGCG
GAGCAAGTGCTGGTGCTGGTGCTGGGGAGTCGAGCGAAGAAGATGATGAAGCGGTGGAGGAGGAGGCGTAGTGGTTGCGCCGTCTGGTCGTACATGTCTA
TGCAAGGAGCAATCAATTGATACGGCACTTGATCTTTCTTGTTATTGGCTATAATAAATGAACTCACCGCTGCTGGACGTATGCAACAGCACAAAGATAG
GCTAATCAATAAACAGTACATATCTTATGTTTATTTATACAGCATAGTTGTATATGATCGTCTCAATGTACTACATAAACCCTCCTTTATGTTGGAGAAT
CCGTACTATACACACTGGCAAGTCGTTGTTACCACCCCGATCCCGCGCCAAGATATCCGGACTTAATTGAAACCCCATACAAATTCCTTTATATCTGTAT
ATGGGACGAGGTCAAAATATACCCTCATATTTGAGGCCGGGAACTAAGGGGTTAAGGCTAGGCTGGTTGTTCAGGGTAACACACAGCTATATGGCATCGG
CTACAAGGAGGTATTCGCTCCCGTGGCCCGCTATGAGTCTTTGCGGGTGCTGTTGGCATTGGCCACAATTCTAGGACTGGAGCTACACCAAATGGATGTA
TCTACAGCCTTTTTAAATGGTATCTTACATGAAAGTATCTATATGAGGCAGCCATTGGGATTTCGTCATGGCACTGGGCACCTTGTATGTAGGTTGAAAA
AGCCTGTATGGGTTAAAACAGGCACCCAGAATCTGGTATGCCGTTCTAAATGAGTTTCTTACCTGTTTAGGATTTTTTAGATGCAAGAAAGAACATTGCT
TGTATCTAAAACGGTGGGATATCAAAGGGATTGAACACATTCTGATCATCTGCGTCTATGTTGACGACCTGACAATTGCGGGCTCACATCTGAGCTCGAT
CAGCGATCTGAAGGCTAAACTGTCTGCAAAGTTTACAATAAAAGACTTGGGCGAGTTGCATTACCTGCTAAAAATGGAGATCAAAAGAGATTCACAAAAG
AAAACACTCAGAATCTCACAGCAGAAGTACATCAACGATCTTCTGGTAAAGTATCAAATGCGAGACTGTAGTACAGAACCCACACCACAAGCGAAAAGTG
TTATATTAGAAAAGGAAAAGGATATGAGCCCAGAACAGATAGCGGCCCAACCATTCGATTACAGAGGTTTAGTGGGTTCACTGATGTATCTTGTCCGAGG
TACTAGACCTGATATTGCTAATGCTGTAAGAGAGCTTAGTAAATATCGATCTTGCTATAATAAGACCCATTGAAGGGCGGCTCAGCGAGTACTAAAGTAC
TTGAAAGGAACGTCGAAGTATGGCATTGAGTACAATGGAAATAGTACCACTAAGTTAGAGCTATACACAGACGCGAGCTTCGCGAATGCATCGGAAGGAA
GGAAGTCAATCACAGGATATGTATCAATACTTGCTGGTGCATGCATCTCTTGGAAAAGCATTAAGCAAGATTGTATTAGTATTCATACAGCAGAATCTGA
ATTAGTAGCCGCTAGTGAAGGTGTTCGAGAGGCGATGTGGTTGAGTCTACTATTGAAAGAATTAGGCTACGGCCAAGTACTATCCACCCAATGCTGGTGT
GATAATACTGCCGCAATAAGTATCATTAAGGATCCTTGCAGTCACTCATCTACCAAGCACATTGATATCAGGCATCTGTATGCCGTGACAAACATGAGGA
CAAAAGTATCATTGTGAATTACTGTAGCACCAACGACATGTTGGCTGATGCCCTTACGAAGCCATTAAGCCAAACACAGTTTGAAAAACTCATGATGGGG
ATAAAAGAG