Description :
From Genome Similarity Track
Location :
Scaffold_185:13168- 14682
Transcript NameFunction/comments
Albla_Nc14093470Chloride Channel (ClC) Family putative
Albla_Nc14093480

Sequence
1514 bases(100 bases per row)
CTCCAGAGCCTTCAAAGAACTATTCAGTCAGAAGAATAAAACGAGAGAAACAAACCTGCTGCTGCGGAAGAGATTTGCGTCAATAAAAGCCCGACTACTG
TGAAGAAAATCGCATGAATGATCCACGCAACGTACTCGGAACCTCCATCCTGCAGTCGATCAATGTATTTCATTCGACGCGCGAGGATGATAGCGTCCAA
TCTGCGAAAGAATCAATGAACTCCCCGACCTCTGACATCCTTTACCATACCTTTTCATGGAGTAGATCACTGGGACTCCAATGATCCCCAAAATGAAGAG
AAAGAAGAGGATTTTGTACTGTCGGGATCGAAGGACAGTCTTATTCGTCGGATTCGAGGTCACTGGGCCAAAGGACGACGCGGTGGATTGTCTTCGAATG
TACATGCATGAATCATGCACATTATCGCTGACAATTTGGACATTATCGGGCAAGCTTTCTGACGATGGACCCTCTACTGATGCCGATGATTGGATGCGTA
CGCGCTGTTGGAACTCTGCGAGACTCTCAATCCGTCCTGTACGTCGAAGATGACTGGGTACGTCTTCCGCGACGGATTGCTTCATATCAATTGCTTTGAT
AACCATTGCCTAATTCTGGATTATTGTCATGCAAATCGTTTCGGTTGAGTCTGAATCAGATGAAAATAACACTACCAATCGGATCGCTCTTTCACGACGA
GAAGGATGGACATGGATCACTCGACAAAGTGTTACTGCATGCGTACAAAGTCCATGCATTTTCTGTAGAAGCGAGATTTTCGTCGCAATAGGCATTTTCG
CATACCAATACACTTGTTCGTATCGCTGGTATTCGATCTATTGAGGCTTTGTAGAAGGCCCAGCTCTTCATTAATAAATGTATTTGCTACTTTATGCGTA
CATTTGTCCTTGAGAAGTCGCTCGACCAATCCTTCCGGCCATATGGACGTTGATGGTGGAAGATTTGGACATAGGGAGATCACTGGAGAGCTGAGTGATC
GCGTGTCAGGTCGATGGGGCTCAAGGTCCTGGGGTTCACGCTCCAGTGATACGAATAGCAGTGCTATTGGAGAGAGTCGCTGGCATGCAGAAGTAGAGAA
AACGCTGCATGAGGTGCATCAAGAGTACCAGCAGAAACGAAACAAGCCAATTCGGCGCGATACAAAGCATAGGGTGGGGTACTTGGACCATGATGATGTG
AGGGATACGAATGAGAAGAGCGCAGGGGGTTTAGCCACTCCGAAAAGCAGCGAAATGGAGGCATTTCTATCACAGTTTGTGTCACAGCAGCGCGACATTA
GTCATCAGATACATCGCGTCCAGGAAAAACTACAGCTCATCGAGGTAAAAGTCGAGCAAGTGGATGATAGAGGAGGTCGAAAAATAGAGGAACAGATAGA
AGGGGAAATGATCGGTCGATGTTGCTTGGAATGGGCAAACGGATTAGCAGATCGGATGGTCCAGGCCTGTGAAAAACTGCCAGAGAGGCTTTACCCCAAG
AGGAATGGCGCGAT