Description :
From Genome Similarity Track
Location :
Scaffold_121:131645- 133641
Transcript NameFunction/comments
Hyaar_Emoy2810243hypothetical protein
Hyaar_Emoy2810244glycosyltransferase

Sequence
1996 bases(100 bases per row)
CTCTCTCTACCATTCACAAATGTTGCTGGTTGAATGCATCATCGTCATTGACGTCTCGAGCACCGCAAAAGAGGTGACGGCATTGTCCAGGCCGAATTCG
GCAAAGTCAAGTACCTGTCCTGCACTTGTATTCAGCAGGACGAACTTGCCCGTACAATTGCTACCAGCGTAGAACGCAATCTTCACTTGGTAGCTATCAG
AAGGGGACCCCATTGCTGGAAGATCCGTCCACTTGGCTGAAGAGATGATGCCACTGAGGTCAGCACAGGGCATATCGTAGCACAGATTAGGGATCGAAAT
GCCAATGATCCGGCGGAGTCGCTTGAAAGCTGGCTCCCTGTAGATCCGCAGCTCCCCTTGCATCATCGCAACGGCGTCTTGCACACGGCAAGTGAGTGCG
ATAACAGCCCCAGCAATAGTACAGAAGTGAAGGTTCATTGGCTTGACAATTAGTCGAGAGGTATGTTGTGTTGGAACCGCTTCAGGTTGAAAAATGGGCA
AAGCAAAGTCGTTCAATGCTGAGCCATTTACCTGGATATATGTTACATCGGAAGTCACCCACTCCACCAGCGTAGGGTCACACGCTCTTGGTATCATCCT
ACCGTGCCCTCGTATGATGTCAACTATGGGTGGTGGTTTTCACCTCGCTTGGCCATTACTACTTCCATACACAGCTGCCTATTGGAAGACTATAGTACGT
TCTGCATACATAGACGTCCACTCGTCCCTCAACACGTGACGAATCCACCTCCAACATATAAGTTCCAGAATCCTCGAAATAGCCCCCACGTCCTTGAAAA
CACGAACATGAAGCTCGAGCCAAACTCGCCGTCACCAGATAGATCGTGATTCTCTCCTAACTCCCGAATGCATTGCTGATAATGTTCGACATTCGCTCCG
CCCGGGTGAGTCGAAGGAGCACCTGATAGACCTCCGTTTGAGAACGATTCCGGTAGAGACTCGACGTTCCAGCAGCTGTCAAACACCAGTCGTCGACGCA
CGCTGTTGCGGCTTAGTAAATGCGAGAGGTAGTAGTCGTCCCCTAGGAAACACGCTTTCGACAGGTTCCTCACTTGAAACGCAGGCATCGTCGCCTCCCC
CATGCCGAAAAACTTTCGCTTTACAGCGACTCCTCCTGCTCCCCCAACGAACGACACGCGGTTTACACCAACTGCGAGGCTCCGTCCACAATAAAGTCCA
TCCTCGGCAGAGATCCACCCACCTAGCACCGCAATGGCGTCGGTTGGGTACTTTTGTGTATAGTGCTGCACGCGTTCACGTAGTTGCGGTGGGTACACAC
GGTCATCATCTCCATAGACAATAATTGTATCTGGATCCTGCTCAACTAACAGCGTCCCGAGCACTTTACTCGCTGGGCCAAGGTCCGTGTCTAACACCAC
AATTCTCACCTTAGGATGGTACGAACTTGTCCCTGTAGCAAAAGAGAGACCGTGGAATTCCGTGCGGTTCAACATCGAATCAGCTGTCAAGAGCCACGAT
GGAATGGTCACGGGACGGTCTTGATATGTCCGAGGGATGATGACGTAGATCGCGTCAAAGTCGTCGGTCTGATGGACGAGCCCATCGAGTGTCGGCTGCA
TCTTGTCGATCCCTTGACTGGTTGTGGTGAAGCTGAAGACCATTCGAGGTCGAGGCTGGGCGGGGTTCATGTTTGTAGTCGTCATCGAGCTCGTGCACCA
AAGGAAGATGGTGATCCAGGCCACGGTCGAGGCCAGAAAGCACGTGAGCCACCGCTTCCATCTCATGTGGTCCCCAAGATCGACCAGCGACTTGAAGACG
ACCTTCTCCTGCAAGGGGTTGACTCTCCGTCGTCGGTTGCGGCAGCGGTGCCAACTGAATAGCAAAGTGCACACTACAAGTCCCGTGAGGACGGAGAAGA
GCGCGAGTCGAGGGGTCATGACCCGTTCCGCGTATAAATCAATGCAAGTCTCGCCACTGAAGGCGTGATTGGTACTGCCAACCGAAGTCCGAAGCG