Description :
From Genome Similarity Track
Location :
Scaffold_986:13163- 15263
Transcript NameFunction/comments
Phypl_g11933phosphatidyl inositol kinase (PIK-A)

Sequence
2100 bases(100 bases per row)
TCGAGTTTTGGGAAAAGTTGCTGGCTCTTGCACCAGAGCTCTTCGAGTCGCGGCAAGCTTTGTACGGAAGTATTGCCCGAATTCGAGGCCGACTGCCATT
AGTGAGCGACGAAGTCGCCTTCTGTGCCCTGGCTGAAAGTGTCGGAAATGTTCACGACGCAGCCGAAAAACTTCACGATGCATCGTACGAGCGAGAGCTC
ACGTACGTAtgtgccgtcgtcgaggtgTCAAAGCAACTGGAACGAGACTTCCCACTGGAGCCGACGCAACTTTCTCTCAAGTCTCCACACGTGTCGCTCC
CTACCATTTCGTCACCTAGGCCAGACACTACCGCTGTCCATGGATCACTTAGTCCTGTTGGGGCGGTGAACTCACGTCGCCTTGTGTTGCCTCCGTATTC
CTCGACTCAATCGACCGCTGCATCGAGCTCCATGCCGAAAAAACATGTTCGAATGAACCAAATGCTCGACTTGCATTTCCAGGAACACATCCAGAAACAG
GAAGCCGCAATCGCAATAACCGAGGCAACGGGGGGCTTTGTGCACCCACACCAGCGAGCTGAGAAGCTAATGGTGCTCCAGGATTTCCGGCAGGCGAACA
ACCTTCTGCTGAACTCGCAACTGGCATTCGGTAGTGAGAAAGCAGCTACATGAGGAAATCTATTCATTATTAGTTGTCTGTCAGGCTAAAATGGAGGAAA
AAGATTAGTGTAGGTGTGGTGGAAATCCACGAGAAAGCTTGACGCGCCTACTTCAGCTTCGTTGCAACCTTGTGGATCCAATCCACAAGAAGAGGGAACA
GAGCGGACACACTGTCGTTGATGAGCCCCAGGAAAAACTGTTCGGCTTGCTCGTCAGTCAAATCCAACCGGAacttctcctccaccttcagCAGAGTTGT
GGCAGGATTCGCTGATATCTCTTCAATTCCAGAGTCGGCCATCAGGCTGAGCAAGTTCAAAATCAGATCGGCACTCTTGCGCAGCCAGTTATACGCTTGA
CAGCAGTACGTTGTAAACTTCTGGTAGTGCTCGCTTGTTGGTCCGCCCATGCCTTCCACCATTTCTTTCGTCAACTTGAACGGAGGCGGGTACGGCTTTG
GATCAGCTCCGAAGACAAAACCGAAATCAATGTGGAGCAAGTGACCCCCGGTCTTCATCATCAGGTTGTCCAAGTGACGATCACCGATTCCCAGAAGATA
CGTCAGTACGCAATAGCCGGCCACCGATTTCACGTATGTACTCAGAGCTTCGGGGGCGATTCCAAACTCCGCACTCGGGTCTGGGTTGTGCTTTCGTAAG
AAGCCCACGATCTGAGGCGATTCGAAGTGGGAGACCACATACGAAACCGGGTACGAATCTTGCACAAACTCCATCAAGCCATCGTTGGCGCCCGTTGCCA
AGATGCGATACGGGGTCAATTTCAAATCCAGGTTCACTTTTTTCAGCAATCGGTCCATCAGAATGAACATTTGCATGATCAGTTGATCTTGCCGAAGATC
GTCACCGTTCTTCACCATGAACTTGTACATTGGTCCCTCCTTTTCGCGGTGCAAGTAACTGATCATACGTGTTGGTAACGACTCACGCATCATGTTGGAG
TCGCTTCCACCAAACATCGACTGACTCAGGTTCGGTGGGTGATGGTTCTCACCTTCAGCAGTGATcgtgtgctggtgctgatcaGTCGGAGGAATCACCG
TCTGGAACTGAATCACGGCCGGGTACATTGCACTCTTGAACATCTTCGCCGAAGTGGCAACAACTCCACTCAAATGAACTGTCGGATCCAGAGGCAGAGA
GATCACAGCCCCCTTAGGCCACGGGAACTGCTTCAGGAAGtgccgcagcttctcctccttctgaTCTTTTCTTCCCTTTTCTTCGCGAGCCTTGTTGTGG
ATTGCCAGGATGTGACTCATGAAGTCGCGTTGCGCCATCAACATGTCGTAGATTGGCTTATTTTCCTCGTCCCGTTTCATTTCCGTGAGCATTTGGTTGA
GTACGATGTGGAAGATCTCCGAGTCGTTCGTTTGTTCACCAGCCTCCACCTTCAGGTACCAGTAGAAGTAGTTGGCCATCTGGAAATTCGTACTCGAGCG