Description :
From Genome Similarity Track
Location :
Scaffold_1343:1316- 3705
Sequence
2389 bases(100 bases per row)
CTCTCCTCAGCGCGGCTGTGGACGAAGATGTTGTCGAAGGAGCTAGGCGTGAAGTCGCGGAGTGGACACAGTATGTGAAACACCATTTGGTTGAAATTGG
CTGGACCGTTCTTTAGACCATGTGGCATTACGAACCACTCACAAAGCATGCTGCTTGGGGTGCTGGCGGCCGTGAGAGGTATATCACCCTCTCACATGAG
GATATGATAGAAGCCATCTGTCAGGTCGGTCGTACTTGAGATAACGGTGCCCGACTTGGAGTCTGAAAGCGTGGACAATGCGCCGGCCACCCGTGGTTAT
CTTCACATAGAAGGTTGGACTCGAATATGGCGACATACTCTCGCGCACATGACCTGCTTCGCACCGACTTTCGAACAACTCATCGATAGCCTTGACTTGG
TCCCGCGGCTGTGGCCACTGACGTGTCACGCATTACTtttgtaacggggttacacgaggTTACACCCGGGGGTATAACCTcacatggatacacttggtgt
cgtgtACATAATTGATGTACGGACACATGAAAAGTGAATGGATGGCTCTGAGCCATCCATGATGCATTTGATTTAGTAATTACTGGTTTTTACTATGTTA
GATAGTTAATCACGTACATTTACACCAAAGCGGCTTGCCgcaataaaaataaataaacagttgagttttggaaactaaagtgtcgagtaccTTTNGtgac
tctctgagtcgaacgtcttcctctgacgctagctaccgcagccccgctgcaaCTTTGTACAAGGCGTGAGATCGATCTCATGGCATATGTTGAATCAGCT
GGCAGTTCAGCGGGAATCTTCTCCGCGAAAACTTCCGCGTACACACTGGCGGTGCATAGGCTGGTTTATCCAAGTTACGAAGAGCTTCCCACGACTGGTC
GGCGAAGCGTTTTTTGCGGGCTGTCTTCGGCTCGGCCCCCACAGGTCGAGTCGGCACGTTTTCCTTGCTGACTGCGTTGATGTCGTGCGTTGAGTTGGCC
TCAGTGATCAAGTACACTTGCTTAATATCGCCGGCCTTGAAGTCGCACAGGAAATCCTCGCAGGGGGTGCGTCTTTCCTTGAGCGTCGCAGCTTAAGGCG
ACGGcgctccaacttcttctcccaCCTCGCCGAAGAGGCGCTGACGGTGGAGAGCGTGTCATCCCCCTCTAGGCGCGGGATCTCGTTCTAAACTGCAGCG
GTTTCATGCGGGAGTCCCTTCGCTCGACCGCCCGAATTCCTCCAGACCGCACAGACTGAACATAGAGGGTCATCACTCTTTCTACATAAGGCATGTATCG
TGGCCAGGACTGTCACGGACGGGGATGGTATGAGAGAGCAGCGACAGACAGGAAGCACGGTAGAAGTTGTTCCATGTTCCAGAATCGGTCAACGCGCGAA
GAGGATGCCGCGCGCATTCGACATGCAGACTGAAAATGATCCGACTCGAGACGCCGCTGGTCGTGGTGGAATTAAACTATGCGTGGAGCACAGTGGGGGC
AGGATGTCGGGCTGGCACCGGGGGACTTGGTCCTCCATTCCAGCCAGTAGGGCACGCCACACGTACTGGGTCCCGGTCGTTTCAAGGCAGAGCTACCGGG
GCGGGTTTATCAACCGCGCCAGTAGCAGCGGTAGCTCTGATCGATGCGAGGCACACCGCCGCACGATGGCCGGTTTTCCACAGCAGAAACAGATCAGTAA
CCCTGTTCGACGGCCACCGCGGGCGGACGACTTTCTGTATCAAATTGTGTAACTCTACCCCGTCACACTCGGGAACGCAAACAAACAGTAGCGGtatgac
atccatcctctCCTGTAAAATTAAATAGGTCTCAGTGTGCATAAAAACTTCTCGATTCGGTGCCCTGTTGATCGTTTGGTGCCCCCGGAGCTGTTCGGTG
GCCCCTAAAATAAATTATTACAATTTCTTGCTTGATGCTATTCTTGATCTTTTTTTGTAAAGCCGATAACTTATCCGGAATGTCGGGGCCGCTAGCTACG
ATCCGAACGGTTATGTCTTCGCCCTCTCTTCCGCTAAGAATATTGCAACTTAAAGCTATGCTAACGAAAAAGCTGCTGACATCGTGATGGATCCTGAACA
ACGCCGTCGCTTCGTTCAGGAAGCTCTATCACGTGAGCCATTCCACCAAGTAAGCAAGCACCCGAGTCTATCTATTGGCAAGACGATCTGGAAGCAAAGG
TAGAGGCAGGACCGCTATCGTTCAAACTTTACAAATAACAATTACGAGAGCGGCGGCGGCACCTTGTGTGAAGTATTGAGCAACACCCGTTGGTATGTCG
TGTCTCCTGCTCTACTTGTCCCTGCTTAAACAAGGCGTTTGCTGCAAGGTGATTTACTTGAGTATTGTATTACATAGTTTATATAAGTT