Description :
From Genome Similarity Track
Location :
scaffold_15:13156- 17020
Transcript NameFunction/comments
g891.t1 hypothetical protein PHYSODRAFT_285243
g892.t1 hypothetical protein PHYSODRAFT_488611

Sequence
3864 bases(100 bases per row)
GAAAGCCGTGGCTTGTGACGAGTGGCCGACCACGTACTACCCCATCGACTTCGAAGACGAGTACAGCGGGGTCAAAACTATTTGAACACCTTGCCCGCCA
AAACGTGATCTCGTTTTCCGTTCGCTCTTGGCTTTACGATGCGTCCATTCCTCTTGGTGACCGCACTACAATTGTAAATCTAACTACCCACTTGTCGGTT
TACAGGTAGCCTAAAGTGTTGCCAGCCATCGTTCGACTATCCTGACGTGCTCGAGCTGCTTTGTTTGACTCGTTTTCAAGAGATGTTTCAGAAGGAAACA
TGTCCACGAGATGCGCTCCCTAGCTTCTTTAGTGGCAATCAATTGTTTGGACAGTGTGTTCGAGTACAATTTGCAAATTCCGCCTTTCGAATGCCGAGAA
TAACGGCGAAGTCAACAAACAAGTCGTCGTCCCTAGCTAGTGCCACCGCGCACCTGGACCAAGTCGACATTGTGATGGTGGAGGTTGATGGCATACGTGA
ACGTATAAGCCATGAAACCGCGTCTACGCCGCAGCTTGAGTCACGGACAATGCCGGAGAAGTGAAAATGGAAGGAAGAAGACGCTGCTGATGGGCAGGGT
CCTGTTCACGTAGTGGTGGTTATTCCTGAGGATCAATCTATGACGTGGAAGACACTCATAAATCAATGATCAGAGGCCGGTGAAGCGGTTGAAAGCTACG
GAAGTGGAAAACTGGGAATGGAAGGAAGAAGAACGGCATAGTTTTGGAGATATTATCTGTTCTTTGTAGACCGTGAGAAAGCGGTGCAGGACCTGGTCAA
GTTCCAAATTCAAGCGTGCCAAGCAAGGAATTGGTGATATATGGGTGATTCCGCTTTGGACAGTGACTTTGGTTTTGGGAATACGACGTCGAAGCGTGTG
AGTCTTATGACGAACTTCTTATGTACGCTGCGTCTGCCGCCTGACGCTCCAAATGAGGGTTGTTTCTGCCTAATTTTCTACAAACATGTAGTTCCAATTG
ATACCCCACGTTCTTTTGGATACATGTATTTTGATTTTGTTTATTCAATGGTTGATACATGGTATCCTGGTTGACTACGGTACCGTAGATCCGCACAGGA
AGATCGCTGTGTGTTTTACTGTTTGGGCTCGGGAATGAGAACGCCACCCTTGGCCCAGTTGGAGCGCTGCACATCGTCGATGTTCATGAAGATGCGGTCC
TTGGGGATGTTAAGCTCCTGACTCACCGTCTCCGTTAGCACAGACGCCGTCTGTGAAGAAGTATATTGTCAAGCTTAGAGCTCCATATCTTTAACAAAGA
TTCTTCATCAGCCAACCTTACCGTGGGGTTGTGCTGTGCGTCCACCTTGCCAATGCTCCTAAGATGAATCATAGCACACGGCTGCAACAATGACAACATA
TCGTAGTTAATACTTAGCACCGTATTACAGCAGCCACTAGGGTTTATCGCATCAACTCACAGCGTCCGAGGCCCCGAACATCATGGGCGTGTCCAGGTTC
AACTGCACCATCACAACTTGCTCCGACTTGTCCAGCGCCGTGGCCACGCCCTTGGAGATCGCCGCCATCGCTTTTGCCGTGTCCACGCCCTTAGATGGCA
CGTTACTCGTCACCTGCACGTTCGGCATTTCTGTCTTGCTTCTTTCTGGTCAAAATGAAAGTATCATATCTGGAAAACCTACTTAGTACTAAGTACGATA
TCAGAGTGATGGTCACGTTGTTTCACTTAAGTGCGCCTTCCGCATTACTGGATCAAGCGTTAGACGGACAAGGCGGCCATGGCTGAGGAGGTGGCGCGCT
CGCGGCAGTATGCGTACCAGCAGAACTCCAACCTAGTGCTACAGGCGGACAGCGAGTCCCGGCGGCGACCAGATGAGCCCACGGGCGAGGTGGAGTCTCT
GGCTGGAAAGATCTCGTATCGAATGGGCGACCGCGCACAGAAGGCGACGCCGCAGAGCAGCCGCAAACGCCACGGTGATCAGGACAAGGACGCTAAGAAG
AGGAAGAAGAGGAGAGGCGACGCTGAAGACGCTGGGGACGGCGTGCTCTTCACAGCCACGGGCGGTCTGGCAACTGCCAAAAGTAATATTCTCAAAGAGA
GTTCAGCATTTGAGTCTGCTGCGTACAGGCCCAAGAACCCCGCGAGCCAGGAAGCTTATGAACAGATCTTGGGGGTTGTCGCCCAGCAGTTAGGAGCCCA
GCCGGGTGAGATCCTAGCTGGAGCGGCGGAAGAAGTGCTGGCCATTCTGAAAAATGACAATTACAGGGACGACGAGAAGCACAAGGAAGTGCAGAAACTG
CTGAAGACCATCCCAGCACACACTTTCAGTCAAATGGTCGCTGCTGGGAAGCGAATCACGGACTTTTCCCTTGAAAATGAAGAAAAGAAGACGGAAGAGG
ACGGAGAAGAAGCTGAGAGTGAGGAGGTGGACAAGGAGATGGGAGTTGCTGTGGTCTTTGATGAAGAAGATGAGTCGGAGGAGTCAGATCTGGATGAAGT
GCGAGAAGAAGAGGAGGAGGAAGAGGAACAAGAAGAAAATACTGCAATGGGACGTGCAGGTATGAAAATGAATGACGGATATGACGATGAAGACGATGGT
GATGTAAAGTACAGGCTAGATGTCCATGCTATCGATGCATTCTGGCTCCAGCGTGAACTGTCGAAGTTTTACACGGACGCAGAAAGTAGCGCCAAGCTGG
CGGAGGATGTGCTGGCTATTCTTAAGGAAGCTGGAAGCGACCTCAGCGCCTGTGAAAATCGACTGGTGCTGCTTCTGGACTACGACAAGTTCGACTTTAT
TAAGCTTCTGTTGGAGAACAGAGCTAAGGTGCTCTACTGCACGAGGTTAAAACAGGCACAGAACGATGAGGAACGACGCAGTATTGAAGAGGAGATGGTC
GCTGATGAGACCCTGGATGACGGCGAAGGAACAGCTATCTTGGAGCAGCTGCGCACCACAGCATCGGCGGACTCATGGATGCAGGATCGTATCGGTGCTA
TGGAGACTACGTCTCGTGCAGAGGCCAACAAGTTGCGTAAGCTGCAACAGAAGGCTGGCGGACAGCGTGCACAGGCTGGTGGGGACGAGTCGGACGATGA
TGTTGACATGGAGAAAGTGAACAGGGATGCCGTGAAGGAGGAGGCGAATGGCGCACCAAAGAAGAAGCCGCAACACTATGTGGACGTCGAGTCTCTCGCG
TTCCAAGAGGGCGGTCATCTTATGAGCAACCGTGAGTGCCGTCTACCGGAAGGCACGTGGCGTGCGCAGAAGAAGGGATACGAAGAAGTCCACGTTCCTG
CCGTTCGCACGAAGATGGCTGTAGCTGAAGAGAAGGCGCGCATTAAGATATCGACGTTGCCAAAGTGGGCTCAGGGCGCGTTCAAGGGCATGGAGTCGTT
GAACCGTGTGCAGTCAAAGATGTTTCCTGCAGCCTTCAAAACGAGCGAGAACCTGCTTCTATGTGCTCCTACAGGTGCTGGTAAGACGAATGTCGCCATG
CTGACGATTTTGCATGAGGTGATGAAAGCGCGTGACCCAGAGACTGGCGAAATCGATCTGAACTCGTTCAAGATTGTCTATGTGGCTCCGATGAAGGCTC
TGGTTCAAGAAGTGGTGCTTAACCTTTCTGCCAGACTGTCCAGCGCTTACGGCATCCAAGTGCGGGAACTTTCAGGTGACCAGAACTTGTCGCGCGAGCA
GCTTTTTAACACACAGATTATTGTGACGACACCGGAAAAGTGGGATATTATCACTCGAAAGTCCGGAGACGACCGCACGTACACCCAACTTGTGCGCCTG
GTGATTATTGATGAAATTCACTTGCTTCACGATACGCGTGGACCGGTGCTGGAGGCTTTAGTTG